Dna primers and oligos. Medical search. Frequent questions

Kary Mullis of Cetus worked on oligonucleotides synthesis for use as probes, primers, and building blocks for various molecular biology techniques. (news-medical.net)
Meanwhile, the team used PCR for other applications by designing new primers and probes, which made the reaction more specific until the results were evident on agarose gel electrophoresis. (news-medical.net)
Visit the LNA Probes product page to download one of four excel order forms for LNA oligos in a single tube or as a ValuMix assay. (biosearchtech.com)
The use of randomers began in the early 1980s when random hexamers were employed in radiolabeling DNA probes [ 1,2 ]. (idtdna.com)
Oligos with these specialty phosphoramidites are often used as primers, probes, or in structural studies. (thermofisher.com)
Our specialized platforms allow us to deliver primers for PCR, dual-labelled probes for qPCR, indexed adapters and fusion primers for sequencing, and a variety of custom products. (idtdna.com)
MGB Eclipse probes and companion primers are manufactured under ISO 13485 conditions, which can help you transition from research to clinical diagnostics. (idtdna.com)
What are the Differences Between DNA and RNA Probes? (enzolifesciences.com)
Specific molecular probes and primers are designed for this purpose. (enzolifesciences.com)
Molecular probes can be broadly categorized into DNA probes and RNA probes, cDNA probes, and synthetic oligonucleotide probes. (enzolifesciences.com)
Nucleic acid probes are either a single stranded DNA or RNA with a strong affinity towards a specific DNA or RNA target sequence. (enzolifesciences.com)
What are DNA probes? (enzolifesciences.com)
A variety of methodologies for labeling DNA are used to generate end-labeled or continuously labeled probes. (enzolifesciences.com)
Probes labeled by nick translation can be used in many different hybridization techniques including: chromogenic in situ hybridization (CISH), fluorescent in situ hybridization (FISH), screening gene banks by colony or plaque hybridization, DNA or RNA transfer hybridization, and re-association kinetic studies. (enzolifesciences.com)

IDT's long-standing reputation as a pioneer and leader in custom oligo manufacturing is primarily due to our proprietary synthesis platforms. (idtdna.com)
In 1971, Gobind Khorana, a Nobel Prize winner for his part in the Genetic Code discovery, and his team of researchers started working on DNA repair synthesis. (news-medical.net)
This technique sought to simplify gene synthesis by using artificial primers and templates that help DNA polymerase to copy the desired gene segments. (news-medical.net)
Following second strand synthesis using DNA Polymerase I and reagents from the MessageAmp II kit (Ambion), ds-cDNA from all barcoded individual cells was pre-amplified by in vitro transcription using T7 RNA polymerase in a pool. (nih.gov)
We are recognised as one of the few oligo houses able to achieve quality complex synthesis as well as large scale synthesis. (biosearchtech.com)
Maintaining accuracy and quality can be challenge when moving from small-scale to large-scale oligo synthesis. (biosearchtech.com)
Expedite complex oligos, large-scale synthesis and special requests by using the Excel oligo order forms. (biosearchtech.com)
This is a fast, easy, and direct approach for expression in cell-free protein synthesis systems using linear DNA templates. (jove.com)
Advanced DNA design and synthesis for genome editing. (synbio-tech.com)
Synbio Technologies's DNA oligo synthesis platform equips state-of-the-art synthesizers and leading professional teams with vast experience in oligo synthesis. (synbio-tech.com)
By leveraging our advanced and innovative manufacturing process, Synbio Technologies offers a wide range of custom DNA oligo synthesis options. (synbio-tech.com)
Synbio Technologies is always competent to provide tailor-made approaches to accomplish every oligo synthesis request. (synbio-tech.com)
ISO 9001 & ISO 13485 quality certifications, extremely low mutation and low error rates, in accordance with the stringent quality control standards for oligo synthesis. (synbio-tech.com)
Professional teams experienced in oligo synthesis and various modifications offer support throughout the entire production progress. (synbio-tech.com)
Synbio Technologies provides a fast and convenient standard DNA oligo synthesis. (synbio-tech.com)
Longer oligos, 96/384 plate batch oligos or other large scale synthesis are available, please contact us for a quote . (synbio-tech.com)
With a micro-synthesis technology platform, Synbio Technologies can provide customers with economized micro-scale oligo synthesis services to help customers avoid the waste of experimental raw materials and reduce unnecessary costs. (synbio-tech.com)
Synbio Technologies has large-scale synthesis and purification facilities that utilize mature and stable industrial synthesis technologies to provide high-quality, large-scale customized oligo synthesis services for global industrial production. (synbio-tech.com)
Read about: Oligo synthesis Oligo usage in diagnostics Oligo usage in therapeutics Phosphoramidites in oligo manufacturing Phosphoramidite considerations for diagnostic applications Phosphoramidite considerations for therapeutic applications, Oligonucleotides (oligos) are short pieces of DNA and RNA. (thermofisher.com)
Random Hexamer and Oligo dT Primers are suitable for first-strand cDNA synthesis with a reverse transcriptase. (thermofisher.com)
This was followed by second-strand cDNA synthesis and end-repair using T4 DNA polymerase, Klenow DNA polymerase and T4 polynucleotide kinase. (nih.gov)
The First Strand cDNA Synthesis Kit is used for the synthesis of the first strand cDNA as the starting reaction for two-step RT PCR.The kit includes Reverse Transcriptase AMV for first strand synthesis, two different primers, our PCR Nucleotide Mix, and Control Neo pa RNA. (sigmaaldrich.com)
Furthermore, the use of Taq or other thermostable DNA polymerases permits labeling reactions to be performed at higher temperatures via PCR, thereby reducing the incidence of enzyme-mediated point mutations during probe synthesis. (enzolifesciences.com)
Alternatively, the primers themselves may be labeled non-isotopically during their own synthesis, negating the requirement for the inclusion of labeled nucleotide precursors as part of the reaction mix. (enzolifesciences.com)

Affinity Plus DNA & RNA Oligonucleotides are custom, single-stranded, and duplexed sequences that contain 1−20 locked nucleic acid nucleotides. (idtdna.com)
Oligo pools are individually synthesized single-stranded DNA sequences that range from 40 to 350 bases. (idtdna.com)
SimpleChIP ® Universal qPCR Master Mix #88989 - Get rapid, sensitive, and precise dye-based qPCR detection and quantitation of target DNA sequences. (cellsignal.com)
Build custom oligos for any application, including unlabeled PCR primers, highly modified oligos, or DNA/RNA hybrid sequences. (biosearchtech.com)
Inventoried oligos comprising all possible sequences for a given length. (idtdna.com)
The REPLI-g Mitochondrial DNA Kit overcomes this limitation by enriching for mitochondrial DNA sequences in total DNA samples. (qiagen.com)
All single-stranded and duplexed DNA sequences are produced with high coupling efficiencies, resulting in high-quality DNA products. (idtdna.com)
DNA Oligonucleotides are short, single- and double-stranded synthetic DNA sequences that can be used in a variety of molecular biology applications. (idtdna.com)
Single-stranded and duplexed DNA sequences, manufactured to your specifications and quality-controlled by mass spectrometry. (idtdna.com)
Random priming is a type of primer extension in which a mixture of small oligonucleotide sequences, acting as primers, anneal to a heat-denatured double-stranded template. (enzolifesciences.com)
Put exonic DNA sequences on a chip. (flashcardmachine.com)
Molecular biology, or the study of living organisms on the molecular level, is closely related to molecular genetics, the study of DNA sequences and how they are controlled and expressed. (biosave.com)

Unrivaled control of oligo specifications ensures batch-to-batch consistency and traceability. (synbio-tech.com)

NEBNext Multiplex Oligos provide adaptors and primers to enable high yield multiplex Illumina library production. (neb.com)
Note: NEBNext ® Multiplex Oligos for Illumina ® (Index Primer Set 1) (NEB #7335S/L) includes 12 indices. (neb.com)
NEBNext Oligos can be used with NEBNext products, and with other standard Illumina-compatible library preparation protocols. (neb.com)
Each set of reagents is functionally validated together through construction and sequencing of genomic DNA libraries on the Illumina sequencing platform. (neb.com)
Inc, Pleasanton, CA, USA) and standard Illumina P5 and P7 primers (P5, AATGATACGGCGACCACCGAGATCT and P7, CAAGCAGAAGACGGCATACGAGAT) and purified with SpriSelect beads (Beckman Coulter Life Sciences). (cdc.gov)
DNA Library Prep Kit for Illumina (ChIP-seq, CUT&RUN) #56795 - Minimize loss of input DNA and generate the highest library yields, even with limited amounts of DNA. (cellsignal.com)
The kit comes with all the enzymes and buffers you need to generate high-quality DNA sequencing libraries from ChIP DNA for NG-seq on the Illumina platform. (cellsignal.com)
Multiplex Oligos for Illumina (Single #29580 or Dual Index Primers #47538) (ChIP-seq, CUT&RUN) - Our adaptors and primers are ideally suited for multiplex sample preparation with the DNA Library Prep Kit (ChIP-seq, CUT&RUN) for NG-seq on the Illumina platform. (cellsignal.com)
EntroGen has launched two sample quality assessment products, the DNA Fragmentation Quantification assay and the Library Quantification kit for Illumina. (genomeweb.com)
The Library Quantification kit for Illumina utilizes primers designed to bind to P5 and P7 adaptor oligos for the detection of properly adaptor-indexed libraries for NGS sequencing on any Illumina instrument. (genomeweb.com)
Fragmented DNA was end repaired and subjected to 18 cycles of LM-PCR using oligos provided by Illumina. (nih.gov)

IDT's primary business is the manufacturing of custom, synthetic DNA and RNA oligonucleotides. (pressebox.com)
Linker phosphoramidites provide options to link oligonucleotides to additional groups (e.g., chemical delivery system for therapeutics, fluorescent dyes, amines, phosphates) or attach to a solid surface like a DNA chip. (thermofisher.com)
Our standard custom DNA oligonucleotides are synthesized on a highly automated, computer-controlled system using cyanoethyl phosphoramidite chemistry and subject to rigorous quality control procedures, just like our Value Oligos. (thermofisher.com)

For additional information on available indices and formats for multiplexing, please refer to the NEBNext Multiplex Oligos Selection Chart . (neb.com)
Our SimpleChIP-qPCR Master Mix, DNA Library Prep Kit, and Multiplex Oligos come with ChIP-specific protocols that make it even easier to perform your entire ChIP experiment. (cellsignal.com)

Integrated DNA Technologies acquires Archer™ next generation sequencing research assays to advance actionable scientific discoveries. (idtdna.com)
Save time and money with ValuMix assays, which consist of probe and primers mixed in a single tube. (biosearchtech.com)
The REPLI-g Mitochondrial DNA Kit is based on the multiple displacement amplification technology (MDA), that enriches for mitochondrial DNA with minimal contamination from nuclear DNA, thus avoiding the need for time-consuming isolation of mitochondrial DNA and increasing the sensitivity of downstream assays. (qiagen.com)
One limitation to the use of mitochondrial DNA has been the need to isolate it from nuclear DNA, particularly in cases where the sensitivity of mitochondrial DNA marker assays needs to be increased. (qiagen.com)
Many new nucleic acid-based diagnostic tools or assays have been developed that allow analysis of DNA and RNA molecules in clinical samples. (enzolifesciences.com)
DNA/RNA probe assays are faster and sensitive so that many conventional diagnostic tests for viruses and bacteria involving culturing of the organisms are being fast replaced by molecular probe assays. (enzolifesciences.com)

mRNA was isolated, heat fragmented and the fragmented mRNA was then converted to single-stranded cDNA using SuperScript III reverse transcriptase and P7-t25-vn oligo-dT primer. (nih.gov)
You use reverse transcriptase to make DNA copies of the mRNA. (flashcardmachine.com)
What is the primer you use for reverse transcriptase in cDNA production? (flashcardmachine.com)

During PCR, barcodes can be incorporated by use of the NEBNext index primers, thereby enabling multiplexing. (neb.com)

In the year 1977, Frederick Sanger identified a DNA sequencing method involving a DNA polymerase, a primer, and nucleotide precursors, for which he was he awarded the Nobel Prize in 1980. (news-medical.net)
Automated oligo synthesizers complete sequential chemical reactions using phosphoramidites to produce the nucleotide chains of synthetic oligos. (thermofisher.com)
A DNA probe is a labeled fragment of DNA that contains a nucleotide sequence specific for the gene or chromosomal region of interest. (enzolifesciences.com)
In the presence of appropriately labeled nucleotide primers, PCR products are labeled as they are being synthesized. (enzolifesciences.com)

Our high quality reagents are available for every workflow, including popular DNA assembly methods such as NEBuilder ® HiFi DNA Assembly and NEBridge ® Golden Gate Assembly . (neb.com)
This kit provides DNA polymerase, buffers, and reagents for specific and uniform whole genome amplification from small samples of human and non-human mitochondrial DNA in total DNA samples. (qiagen.com)
We thrive when we work closely with our customers by offering our technical expertise to deliver high-quality extraction chemistries, oligos, PCR reagents, quality control solutions and instrumentation so they can get the results they desire. (biosearchtech.com)

Megamer Single-Stranded DNA Fragments are sequence-verified ssDNA fragments 201-2000 bases in length. (idtdna.com)
Try multiple probe types early in assay development and select the type that performs best with your specific application and oligo sequence. (biosearchtech.com)
OPRM1 A118G was screened by DNA sequence analysis of polymerase chain reaction (PCR)-amplified DNA. (spandidos-publications.com)
IDT's easy-to-use online fusion primer design tool uses a gen-specific data base number or a supplied reference sequence to build appropriate 454 FusionPrimers for targeted DNA regions, including individual exons or all exons from one or more genes. (pressebox.com)
The software takes into account performance metrics of the entire fusion primer rather than simply adding 454 Life Sciences' universal adaptor sequence to an otherwise standard PCR primer. (pressebox.com)
A later application was the use of random sequence primers to detect random amplified polymorphisms (RAPDs) [ 3,4 ]. (idtdna.com)
Comparative genomic hybridization (CGH) has been developed to elucidate genome-wide sequence copy number variation (CNV) between different genomes, such as the differential amplification or deletion of genetic regions between tumor DNA and normal DNA from neighboring unaffected tissue [ 7-10 ]. (idtdna.com)
B ) Arl13b DNA and relevant amino acid sequence with the RVEP sequence in the orange box and the T-to-C mutation highlighted in pink. (elifesciences.org)
Due to its high processivity and strand displacement activity, REPLI-g DNA Polymerase is capable of amplifying up to 100 kb without dissociating from the DNA template and minimizes unequal sequence and locus representation compared with PCR-based amplification methods. (qiagen.com)
Amplified fragments between 150 and 300bp (representing shear fragments between 50 and 200nt in length and ~100bp of primer sequence) were isolated by agarose gel electrophoresis and purified. (nih.gov)
Using the Oligo Entry ordering tool, you can design your oligos to contain any DNA sequence you require and select from hundreds of modifications to suit your specific research needs. (idtdna.com)
at a site determined by a sequence-specific primer. (sigmaaldrich.com)
Then compare the production by tumor and regular cells as they hybridize to the exonic DNA sequence on the chip. (flashcardmachine.com)
Multilocus sequence typing (MLST) is the use of DNA dorferi ( 9 , 10 ). (cdc.gov)

The unique hairpin loop structure of the NEBNext Adaptor minimizes adaptor-dimer formation, and NEBNext index PCR primers enable index incorporation during library amplification. (neb.com)
Incorporating a novel hairpin loop structure, the NEBNext Adaptor ligates with increased efficiency to end-repaired, dA-tailed DNA. (neb.com)

454 Life Sciences, a Roche company, and Integrated DNA Technologies, Inc., Coralville, USA announced today they have entered into an exclusive co-promotional agreement wherein IDT will design, synthesize, and purify the fusion primers required for certain 454 Sequencing applications. (pressebox.com)

ACE I/D polymorphism genotypes were determined by using polymerase chain reaction with specific primers. (molvis.org)
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) for reverse transcription of RNA into complementary DNA. (sigmaaldrich.com)

Both products determine quantity and quality of DNA samples prior to running downstream qPCR. (genomeweb.com)
Residual amounts of amplified genomic DNA are minimized and do not interfere with mitochondrial-specific downstream methods such as qPCR or direct Sanger sequencing. (qiagen.com)

Most components in our manufacturing process are designed and developed in-house, including specialized synthesizers that accommodate the most demanding oligo requests and high-throughput automation systems that help to ensure fast turnaround times. (idtdna.com)

The batch is then tested by synthesizing test randomer oligos and confirming base composition by enzymatic degradation and HPLC. (idtdna.com)
Order today and receive your HPLC-purified oligos in 2 business days. (idtdna.com)

New England Biolabs, Ipswich, MA) with random hexamers and oligo dT. (cdc.gov)

With our Normalized Oligos, we've made obtaining pure DNA oligos in bulk quantities (up to 10 grams) easy, and many options can now be ordered via our online ordering system! (idtdna.com)
Large scale and bulk custom DNA oligos can be ordered with the same high purity, competitive prices, and fast turnaround. (synbio-tech.com)

Quantitative PCR was performed with 20 (red line), 4 (orange line), 0.8 (purple line), and 0.016 (blue line) ng of input DNA and either SimpleChIP ® Human α Satellite Repeat Primers #4486 (left two panels) or SimpleChIP ® Human RPL30 Exon 3 Primers #7014 (right two panels), using SimpleChIP ® Universal qPCR Master Mix #88989 (upper two panels) or Market Leader (lower two panels). (cellsignal.com)
SimpleChIP ® Universal qPCR Master Mix shows equivalent amplification efficiency across a wide range of input DNA amounts as compared to the market leader. (cellsignal.com)
Expand beyond standard qPCR probe chemistries and take advantage of our versatile suite of oligo options to get exactly what you need. (biosearchtech.com)

Take advantage of our expertise and experience to build high quality research-grade oligos to your exact specifications with our large selection of probe chemistries, modifications, purification options and manufacturing scales. (biosearchtech.com)
The total price of oligo=price/base*nt + purification price. (synbio-tech.com)
The EZ2 AllPrep DNA/RNA FFPE Kit is designed for automated purification of DNA and RNA from FFPE samples, using magnetic-bead technology and prefilled cartridges. (qiagen.com)

High resolution analysis of DNA copy number variation using comparative genomic hybridization to microarrays. (idtdna.com)

In addition, your oligos will be quality controlled via proprietary ESI-MS *, and quantified twice by UV spectrophotometry to provide yield measurements. (idtdna.com)
Degree of automation. The EZ2 Connect workflow for extraction using the AllPrep DNA/RNA FFPE Kit offers a clear automation advantage: approximately 50% of the entire run time is automated and requires 35 minutes less hands-on time than the workflow from Supplier TS. "> Degree of automation ") and provides superior nucleic acid yields from FFPE samples compared to manual workflows and workflows from other suppliers (figure " DNA and RNA yields from human spleen. RNA and DNA was extracted from human spleen FFPE tissue samples, according to manufacturer‘s instructions. For the EZ2 AllPrep DNA/RNA FFPE Kit, the fast decrosslinking workflow was used. Nucleic acid yield was quantified using a Qubit RNA HS Assay or a Qubit dsDNA BR Assay. "> DNA and RNA yields from spleen FFPE . (qiagen.com)
figure " DNA and RNA yields from human spleen. RNA and DNA was extracted from human spleen FFPE tissue samples, according to manufacturer‘s instructions. For the EZ2 AllPrep DNA/RNA FFPE Kit, the fast decrosslinking workflow was used. Nucleic acid yield was quantified using a Qubit RNA HS Assay or a Qubit dsDNA BR Assay. "> DNA and RNA yields from human spleen . (qiagen.com)

Reliable hot start Taq DNA Polymerase for sensitive detection of low abundance target DNA. (biosearchtech.com)

A ) Schematic of Arl13b gene and donor oligo (orange bar) at exon 8 used to generate the V358A causing point mutation. (elifesciences.org)

We are pleased to leverage IDT's significant experience in primer design and construction to offer our customers a one-stop solution for all their targeted resequencing projects,' explained Chris McLeod, CEO of 454 Life Sciences, a Roche company. (pressebox.com)
By shifting the task of primer design to IDT's online tool, researchers can now focus their efforts on making discoveries. (pressebox.com)

Order custom oligos in plates for cost competitive value without compromising on quality. (biosearchtech.com)
Integrated DNA Technologies (IDT) is the largest supplier of custom nucleic acids in the United States, serving academic, government, and commercial researchers in biotechnology, clinical diagnostics, and pharmaceutical development. (pressebox.com)
Today, IDT synthesizes and ships an average of 36,000 custom oligos per day to more than 77,000 customers worldwide. (pressebox.com)
This allows us to provide high-quality custom DNA oligo products to scientific researchers and industrial customers around the world. (synbio-tech.com)

Single strand annealing proteins (SSAPs) like Redβ initiate homologous recombination by annealing complementary DNA strands. (nature.com)
By mechanism, DNA annealing proteins are divided into ATPases capable of strand invasion (RecA, RAD51) and single strand annealing proteins (SSAPs) that do not utilize ATP 4 . (nature.com)
As opposed to single strand (ss) DNA binding proteins such as SSB and RPA, which protect and occlude ssDNA from recombination, RAD52/Redβ SSAPs promote recombination and share several biochemical similarities. (nature.com)
He added a second primer to the opposite strand and realized that repeated use of DNA polymerase will trigger a chain reaction that will amplify a specific DNA segment, thus discovering the PCR technology. (news-medical.net)

In the year 1953, Watson and Crick discovered the double-helix structure of the DNA, showing that DNA has two strands with complementary bases running in opposite directions. (news-medical.net)
Sequencing Primersare complementary to common cloning vectors elements and allow for sequencing of cloned DNA. (thermofisher.com)
It is complementary DNA. (flashcardmachine.com)
DNA complementary to the RNA. (flashcardmachine.com)

1. Feinberg AP, Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity . (idtdna.com)
The chromatin extracts containing DNA fragments with an average size of 500 bp were immunoprecipitated using different antibodies. (nih.gov)
For subcloning of DNA fragments from BACs and cosmids using the Red/ET Recombination System. (biosave.com)

Our extensive selection of nucleic acid derivatives and specialty building blocks is critical to our ability to synthesize high quality and structurally complex oligos. (biosearchtech.com)
These kits generate high yields of genomic DNA, total cellular DNA or total nucleic acids (TNA) in under 60 minutes. (biosearchtech.com)

Our ability to control these variables allows us to consistently produce high-quality oligos for use in routine and specialized applications. (idtdna.com)
Long, high-quality DNA oligos up to 200 bases. (idtdna.com)
You can rely on us to deliver high quality, bespoke oligos from small-scale RUO needs through the demands of commercial production. (biosearchtech.com)

The fast, user-friendly workflow also cuts down on the hands-on time needed for generating and purifying DNA libraries. (cellsignal.com)
The final 3'Seq libraries were then generated by PCR amplification of the linker-ligated cDNA with P5 and P7 primers. (nih.gov)

mRNA from individual cells was reverse transcribed with a primer containing a cell-identifying barcode followed by oligo(dT). (nih.gov)
mRNA transcripts for osteopontin were determined using RT- -PCR with specific primers. (bvsalud.org)
Transcrições de mRNA para osteopontina foram determinadas através de RTPCR, com primers específicos. (bvsalud.org)

In 1984, Mullis along with the genetic mutation assay team at Cetus started working on experiments that show PCR's ability to amplify genomic DNA. (news-medical.net)
Purified immunoprecipitated DNA were prepared for sequencing according to a modified version of the Solexa Genomic DNA protocol. (nih.gov)
Genomic DNA obtained from 262 persons (122 patients with ankylosing spondylitis and 140 healthy controls) was used in the study. (molvis.org)

They are weak ssDNA binding proteins with no affinity for double-stranded (ds) DNA. (nature.com)
It involves randomly nicking the backbone of a double-stranded DNA with dilute concentrations of DNase I. At extremely low concentrations, this enzyme nicks a template at four or five sites, producing a free 3′-OH group that can act as a primer at each nicking location. (enzolifesciences.com)

Although the amplification product was not evident in agarose gel electrophoresis initially, Southern blotting confirmed the increase in quantity of the desired DNA segments. (news-medical.net)

Technologies Inc., Coralville, Iowa) spiked with additional primers designed for Omicron amplification (https://community.artic.network/t/sars-cov-2-v4-1-update-for-omicron- variant/342) using Q5 Hot Start HighFidelity 2X Master Mix (New England Biolabs). (cdc.gov)

The DNA Fragmentation Quantification assay evaluates the amount of amplifiable DNA in a sample, and detects the presence of PCR inhibitors. (genomeweb.com)

Single-stranded DNA oligos specifically built for your homology‑directed repair (HDR) experiments. (idtdna.com)

We can provide mass production of oligos with high purity from milligram to gram quantities. (synbio-tech.com)

The REPLI-g Mitochondrial DNA Kit is intended for molecular biology applications. (qiagen.com)
The EZ2 AllPrep DNA/RNA FFPE Kit (48) is intended for molecular biology applications. (qiagen.com)

The partnership offers Genome Sequencer FLX System users a convenient solution for primer creation, streamlining workflow and relieving bioinformatics burdens. (pressebox.com)
The REPLI-g Mitochondrial DNA Kit provides specific amplification of the whole human mitochondrial genome, and yields approximately 4 µg of amplified mitochondrial DNA per reaction. (qiagen.com)
REPLI-g Mitochondrial DNA technology provides fast and highly uniform DNA amplification across the entire mitochondrial genome. (qiagen.com)
The method is based on multiple displacement amplification (MDA) technology, which carries out isothermal genome amplification utilizing a uniquely processive DNA polymerase. (qiagen.com)

Specific applications include de novo sequencing and re-sequencing of genomes, metagenomics, RNA analysis, and targeted sequencing of DNA regions of interest. (pressebox.com)

A better understanding of how these species cause disease and spread antibiotic resistance requires a knowledge of how its genes are controlled, on both the DNA and the RNA level. (frontiersin.org)
Recently, we showed that linear DNA can be much better protected in lysates from cells knocked out for exonuclease genes ( recBCD ) 10 . (jove.com)
Orthopoxviruses and Monkeypox virus were detected in the organs by PCR using consensus primers targeting the virus surface membrane haemagglutinin (HA) genes, while Leptospira species were detected by PCR using primers targeting the rrs and lfb1 genes. (who.int)

DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. (idtdna.com)

DNA oligos up to 120 bases manufactured by an exclusive production process to minimize oligonucleotide crosstalk. (idtdna.com)
Thermo Scientific DNA phosphoramidites are built to meet the varying needs of oligonucleotide manufacturers for the development of therapeutic, diagnostic, and research applications. (thermofisher.com)
Oligonucleotide therapeutics are an up-and-coming class of drugs comprised of short DNA and/or RNA molecules that modulate the expression of target RNA for the treatment of diseases. (thermofisher.com)

By using cell extracts from exonuclease-deficient knockout cells, linear DNA templates remain intact without requiring any end-modifications. (jove.com)

Quantification of ChIP DNA enriched using Tri-Methyl-Histone H3 (Lys4) (C42D8) Rabbit mAb #9751 , TCF4/TCF7L2 (C48H11) Rabbit mAb #2569 , and Normal Rabbit IgG #2729 by SimpleChIP ® Plus Enzymatic Chromatin IP Kit (Magnetic Beads) #9005 . (cellsignal.com)

The amplified DNA from PCR was successfully cloned and sequenced by the researchers, who applied for patent on PCR and its applications and got the patent approved in 1987. (news-medical.net)
Do you require large numbers of oligos for high-throughput applications? (biosearchtech.com)
A number of powerful applications are made possible by the system's highly accurate long reads and simplified by this new primer design tool. (pressebox.com)
We offer a range of pre-designed oligos for a variety of applications. (thermofisher.com)
Simple, rapid extraction of PCR-ready DNA for screening and genotyping type applications from hair follicles, quill-end cells of feathers, tissue-culture cells, buccal cells and other sample types. (biosearchtech.com)

For amplification of non-human mtDNA, the REPLI-g Human mt Primer Mix needs to be substituted with an appropriate primer mix suitable for that species (not provided with the kit). (qiagen.com)
Our mag kits are a high-throughput and cost-effective DNA isolation method suitable for PCR, sequencing and genotyping. (biosearchtech.com)

Using linear DNA templates for CFPS will further enable the technology to reach its full potential, decreasing the experimental time by eliminating the steps of cloning, transformation, and plasmid extraction. (jove.com)
It automates the extraction of both DNA and RNA, from exactly the same piece of sample in two distinct elution fractions. (qiagen.com)

Convenient for small numbers of oligos and standard amounts synthesized up to 1 μmol. (biosearchtech.com)
Preparing plasmid DNA depends on many time-consuming steps during cloning and large amounts of DNA isolation. (jove.com)

Our DNA succinates are formulated as triethylammonium (TEA) salts with standard base protection. (thermofisher.com)
IDT maintains an extremely high standard for traceability for the manufacturing of your GMP oligos. (idtdna.com)

However, it was not until 1983 that, in an effort to fix some issues in his research work, Mullis used Sanger's DNA sequencing method as a basis to devise a new technique. (news-medical.net)
454 Life Sciences, a center of excellence of Roche Applied Science, develops and commercializes the innovative 454 Sequencing System for ultra-high-throughput DNA sequencing. (pressebox.com)
Reliable DNA sequencing services. (synbio-tech.com)

Each pool can be designed with up to 20,000 oligos in a single tube. (idtdna.com)
Additional single- or dual-barcode primer options are available, in 12- and 96- index formats (NEB #E7500 , NEB #E7710 , NEB #E7730 , NEB #E6609 , NEB #E7600 ). (neb.com)
Although this technique used DNA polymerase repeatedly, similar to PCR, it employed only a single primer template complex, and exponential amplification was not possible using this technique. (news-medical.net)
2 oligos premixed in a single tube. (idtdna.com)
2 oligos, annealed and delivered in a single tube. (idtdna.com)

Anatomy2

Organisms5

Chemicals and Drugs45

Analytical, Diagnostic and Therapeutic Techniques and Equipment15

Phenomena and Processes28

Anthropology, Education, Sociology and Social Phenomena1

Technology, Industry, Agriculture2

Information Science7

Health Care1

Probes14

Synthesis24

Sequences12

Control of oligo specifications1

Illumina11

Oligonucleotides3

Multiplex2

Assays6

Reverse transcriptase3

Index primers1

Nucleotide4

Reagents3

Sequence14

Adaptor2

Fusion primers1

Polymerase chain re2

Downstream2

Synthesizers1

HPLC2

Random hexamers1

Bulk2

QPCR3

Purification3

Microarrays1

Yield3

Detection1

Gene1

IDT's2

Custom4

Strand4

Complementary4

Fragments3

Nucleic2

High-quality3

Libraries2

MRNA3

Genomic DNA3

Double-stranded2

Agarose gel electrophor1

Coralville1

Assay1

Homology1

Quantities1

Molecular biology applications2

Genome4

Specific1

Genes3

Polymorphisms1

Oligonucleotide3

Modifications1

Quantification1

Applications5

Suitable2

Extraction2

Amounts2

Standard2

Sequencing3

Single5