MutationsProteinsMolecularProteinSequencesDifferentiationProliferationOverexpressionMRNASynthesisTissuesFunctionalCharacterizationRNAiNucleotide SequenceLocalizationSubsequentlyVectorRegulationVariety of genesPutativeVectorsEndothelialCellularHomologPhenotypesAccessionTumor suppPromotersGeneticMoleculesColorectal CancerStem cellsRodentMammalian1990EukaryoticAntigenInducesIdentification15,0001991Full-lengthMonoclonalMiceBiologicalMantle cell lymMetastasisChromosomeMurineInduce
Mutations11
- Deep sequencing studies show that 4.2% of tumours carry activating mutations in GNAS (encoding Gα s ), and that oncogenic activating mutations in genes encoding Gα q family members ( GNAQ or GNA11 ) are present in ∼ 66% and ∼ 6% of melanomas arising in the eye and skin, respectively. (nature.com)
- Blue squares indicate phenotypes directly attributed to mutations/alleles of this gene. (jax.org)
- Mice homozygous for targeted mutations in this gene are viable, fertile and phenotypically normal. (jax.org)
- Each coding sequence (CDS) was amplified for 25 cycles with gene-specific primers and high-fidelity polymerase, minimizing PCR-induced mutations risk. (horizondiscovery.com)
- Nevertheless, NDRG1 sequencing assay disclosed no mutations in the gene. (scirp.org)
- Next, we discuss mutations of genes related to autophagy and the UPR in CRC. (bvsalud.org)
- Mutations in the genes encoding a calcium channel (Ca V 1.1) and a sodium channel (Na V 1.4) have been identified in HypoPP families. (jci.org)
- For practical purposes, depending on the enzyme activity and the presence of mutations in the G6Pase and T genes, respectively, GSD type I may be subdivided into 2 major forms. (medscape.com)
- It is an autosomal recessive disorder in which there is an AGL gene mutations which causes deficiency in glycogen debranchinging enzyme and limited storage of dextrin. (medscape.com)
- Accumulating evidence shows that tRNA expression and mutations are associated with various diseases such as neurological pathologies and cancer development3,4. (cdc.gov)
- Zettner MA, Flor S, Ludewig G, Wagner J, Robertson LW, Lehmann L. Quinoid metabolites of 4-monochlorobiphenyl induce gene mutations in cultured Chinese hamster v79 cells. (who.int)
Proteins9
- Aberrant expression, overexpression or signal reprogramming of GPCRs and G proteins in tumour cells can contribute to cancer development and progression. (nature.com)
- Aberrant expression and activity of G proteins and G-protein-coupled receptors (GPCRs) are frequently associated with tumorigenesis. (nature.com)
- Overexpression of the cDNA-encoded TIF3 and TEF-1d proteins in NIH3T3 cells was oncogenic as evidenced by the appearance of transformed foci capable of anchorage-independent growth on soft agar and tumorigenesis in nude mouse. (cdc.gov)
- Blocking the translation of TIF3 and TEF-1d proteins using the corresponding antisense mRNA resulted in a significant reversal of the oncogenic potential of cadmium transformed Balb/c-3T3 cells as evidenced from the suppression of anchorage-independent growth on soft agar and diminished tumorigenesis in nude mouse. (cdc.gov)
- MHC class II-associated proteins in B-cell exosomes and potential functional implications for exosome biogenesis. (genscript.com)
- In response to a brain injury, astrocytes proliferate and become hypertrophic with an increased expression of intermediate filament proteins. (jneurosci.org)
- Iron and BIM (Bcl-2-interacting mediator of cell death) proteins were involved in the cytotoxic sensitization process. (jneurosci.org)
- These findings suggest that while channel proteins found in sperm cells from different species look similar and serve similar roles, they are activated in ways that can be very different. (elifesciences.org)
- constructed lentiviral pseudotypes harboring S, M, or E proteins and found that only S supported viral entry into target cells ( 26 ). (cdc.gov)
Molecular15
- Molecular characterization and expression of heparan-sulfate 6-sulfotransferase. (nih.gov)
- The molecular sequence of this clone aligns with the gene accession number as a point of reference only. (origene.com)
- This gene encodes the iota polypeptide chain that is associated with the Ig-mu chain to form a molecular complex which is expressed on the surface of pre-B cells. (nih.gov)
- Up-regulation of expression of translation factors - a novel molecular mechanism for cadmium carcinogenesis. (cdc.gov)
- The molecular mechanisms potentially responsible for cadmium carcinogenesis were investigated by differential gene expression analysis of Balb/c-3T3 cells morphologically transformed with cadmium chloride. (cdc.gov)
- These findings demonstrate that the up-regulation of expression of TIF3 and TEF-1d is a novel molecular mechanism responsible, at least in part, for cadmium carcinogenesis. (cdc.gov)
- Molecular cloning of cDNAs encoding bovine and human lactoperoxidase. (rusmedserv.com)
- Sakamaki K, Tomonaga M, Tsukui K, Nagata S. Molecular cloning and characterization of a chromosomal gene for human eosinophil peroxidase. (rusmedserv.com)
- While studies have been performed on tracking molecular developments that take place within cells during drug treatment, the outcomes following treatment have yet to be extensively studied. (cbirt.net)
- Although the molecular genetics of MMe is known, including BRCA1-associated protein-1 (BAP1) gene alterations, the prognosis of MMe patients remains poor. (mesothelioma-line.com)
- Here, we generated BAP1 knockout (BAP1-KO) human mesothelial cell clones to develop molecular-targeted therapeutics based on genetic alterations in MMe. (mesothelioma-line.com)
- The murine homologue of the T lymphocyte CD2 antigen: molecular cloning, chromosome assignment and cell surface expression. (ox.ac.uk)
- The molecular interactions of genes and gene products underlie fundamental questions of biology. (lu.se)
- 1990. Cell replication and unscheduled DNA synthesis (UDS) activity of low molecular weight chlorinated paraffins in the rat liver in vivo. (cdc.gov)
- During the early 1990s, breakthroughs in cloning and sequencing of Norwalk virus and Southampton virus ( 15--18 ) led to the development of sensitive molecular assays (e.g., reverse transcription-polymerase chain reaction [RT-PCR]), nucleotide hybridization probes, and enzyme-linked immunosorbent assays (ELISA) that used baculovirus-expressed viral antigens ( 19--33 ). (cdc.gov)
Protein21
- Probable G-protein coupled receptor 135 is a protein that in humans is encoded by the GPR135 gene. (wikipedia.org)
- The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. (nih.gov)
- These sequences represent the protein coding region of the LCE1M cDNA ORF which is encoded by the open reading frame (ORF) sequence. (genscript.com)
- GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. (genscript.com)
- Protein expression is influenced by many factors that may vary between experiments or laboratories. (genscript.com)
- We have now cloned a mouse homolog of the human pS2 cDNA to dispose of an animal model to study the pS2 protein function, which remains unknown at the present time. (xenbase.org)
- We show that the mouse putative pS2 protein sequence and the physiological pattern of expression of the mouse pS2 gene are well conserved. (xenbase.org)
- Expression of the pNR-2/pS2 protein in diverse human epithelial tumours. (xenbase.org)
- The protein encoded by this gene belongs to the immunoglobulin superfamily and is expressed selectively at the early stages of B cell development, namely, in proB and early preB cells. (nih.gov)
- These alterations may arise from cancer-specific changes in gene copy number, as well as from other genetic, epigenetic and post-translational changes resulting in higher protein expression, thereby enhancing tumour progression and metastasis. (nature.com)
- Transfection of mammalian cells with an expression vector containing either TIF3 or TEF-1d cDNA resulted in overexpression of the encoded protein. (cdc.gov)
- A human T cell-specific cDNA clone encodes a protein having extensive homology to immunoglobulin chains. (jax.org)
- Human thyroid peroxidase (TPO) isoforms, and TPO-2: analysis of protein expression in Graves' tissue. (rusmedserv.com)
- The microtubules in cells that make smaller amounts of this protein were more disorganised, and these cells were unable to fuse with each other to form muscle cells. (elifesciences.org)
- Expression levels of mouse Akt2 mRNA and Akt2 protein varied among tissues, with the highest levels in skeletal muscle. (nih.gov)
- Forced expression of lcn2 or treatment with LCN2 protein increased the sensitivity of astrocytes to cytotoxic stimuli. (jneurosci.org)
- LCN2 protein induced upregulation of glial fibrillary acidic protein (GFAP), cell migration, and morphological changes similar to characteristic phenotypic changes termed reactive astrocytosis. (jneurosci.org)
- In this process, astrocytes proliferate to fill gaps and undergo a typical morphological change: a large cytoplasmic mass, long and branched processes, and increased expression of intermediate filaments such as glial fibrillary acidic protein (GFAP). (jneurosci.org)
- A genome-scale library of Gateway-adapted human ORF clones, the CCSB Human ORFeome Library (aka hORFeome V5.1) is ideal for transferring thousands of open reading frames into a variety of protein expression systems. (horizondiscovery.com)
- Actin- and myosin-binding protein implicated in the regulation of actomyosin interactions in smooth muscle and nonmuscle cells (could act as a bridge between myosin and actin filaments). (hmdb.ca)
- cDNA microarray and quantitative RT-PCR (qRT-PCR) analyses revealed high expression of a calcium/calmodulin-dependent protein kinase type II subunit delta (CAMK2D) gene in the BAP1-KO cells. (mesothelioma-line.com)
Sequences3
- However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. (origene.com)
- The following LCE1M gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). (genscript.com)
- ORF sequences can be delivered in our standard vector, pcDNA3.1 + /C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. (genscript.com)
Differentiation23
- Ezh2 orchestrates gene expression for the stepwise differentiation of tissue-specific stem cells. (genscript.com)
- The complex is thought to regulate Ig gene rearrangements in the early steps of B-cell differentiation. (nih.gov)
- Cloning, expression, and differentiation-dependent regulation of SMAF1 in adipogenesis. (nih.gov)
- The microtubule cytoskeleton is critical for muscle cell differentiation and undergoes reorganisation into an array of paraxial microtubules, which serves as template for contractile sarcomere formation. (elifesciences.org)
- We show that oMAP4 is expressed upon muscle cell differentiation and is the only MAP4 isoform essential for normal progression of the myogenic differentiation programme. (elifesciences.org)
- Upon differentiation, mono-nucleated myoblasts withdraw from the cell cycle and fuse to form syncytial myotubes ( Wakelam, 1985 ). (elifesciences.org)
- These data demonstrate that Akt2 expression is activated during cellular differentiation and suggest that it functions in the signaling pathways of some adult tissues. (nih.gov)
- N-myc downstream regulated gene 1 (NDRG1), also known as differentiation related gene 1, was previously identified as an up - regulated gene upon cellular differentiation. (scirp.org)
- Even though its sequence along with its expressional pattern in cancer cell lines are evident, the functional aspects concerning cell proliferation, viability, differentiation and cell cycle regulation of NDRG1 remains vague. (scirp.org)
- This resulted in over-expression of NDRG1, which in turn markedly up regulated two differentiation markers of the prostate tissue, p21 and cytokeratin 8/18. (scirp.org)
- These results revealed that NDRG1 is functional in prostate cancer cells and able to induce expression of differentiation factors through p53 independent pathway. (scirp.org)
- T. Napso, N. Azzam, A. Lerner and F. Fares, " N-myc Downstream Regulated Gene 1 Increases Differentiation Factors Level in Human Prostate Cancer Cells without Affecting Cell Proliferation and Cell Cycle Profiles," Journal of Cancer Therapy , Vol. 4 No. 2, 2013, pp. 568-574. (scirp.org)
- A Novel Gene Which Is Up-Regulated during Colon Epithelial Cell Differentiation and Down-Regulated in Colorectal Neoplasms," Laboratory Investigation: A Journal of Technical Methods and Pathology, Vol. 77, No. 1, 1997, pp. 85-92. (scirp.org)
- N. van Belzen, W. N. Dinjens, B. H. Eussen and F. T. Bosman, "Expression of Differentiation-Related Genes in Colorectal Cancer: Possible Implications for Prognosis," Histology and Histopathology, Vol. 13, No. 4, 1998, pp. 1233-1242. (scirp.org)
- Thus, exogenous AhR induced catecholaminergic differentiation in N2a-Rα cells. (biomedcentral.com)
- The excessive activation of AhR resulted in neural differentiation of Neuro2a cells. (biomedcentral.com)
- Activated AhR may disrupt the strictly regulated brain formation with irregular differentiation occurring rather than cell death. (biomedcentral.com)
- Aim: To detect the expression of molecules associated with Notch signaling pathway in stem cells from human exfoliated deciduous teeth (SHED) cultured in specific differentiation medium, namely, keratinocyte growth medium (KGM). (bvsalud.org)
- Notch-1, Jagged-1, Jagged-2, and stem cell marker Nanog are expressed in SHED cultured in KGM which may be involved in the differentiation into epithelial-like cells in human dental pulp tissues. (bvsalud.org)
- Since the Notch signaling pathway molecules play an important role in differentiation of epithelial cells, it is important to identify the presence of notch signaling molecules in SHED during the process of cell differentiation. (bvsalud.org)
- The Notch signaling pathway provides important intercellular signaling mechanisms essential for cell fate specification and it regulates differentiation and proliferation of stem or progenitor cells by para-inducing effects 3-4 . (bvsalud.org)
- Notch signaling pathway is also involved in the regulation of epithelial cell differentiation in various tissues 5-6 . (bvsalud.org)
- The aim of this study was to detect the expression of molecules associated with Notch signallng pathway in SHED cultured in specific differentiation medium, namely, KGM. (bvsalud.org)
Proliferation11
- Its roles include regulation of proliferation, promotion of immune system and activation of apoptosis in B cells. (intechopen.com)
- In these cells, IL-21 does not promote proliferation but enhances apoptosis and chemotaxis. (intechopen.com)
- miR‑223 and/or PAX6 were overexpressed and knocked down in U251 and U118 cells, and the half maximal inhibitory concentration (IC50) of TMZ and cell proliferation under TMZ treatment were used as measures of TMZ chemoresistance. (spandidos-publications.com)
- The results demonstrated that overexpression of miR-223 in GBM cells markedly decreased TMZ-induced inhibition of cell proliferation and increased TMZ IC50, which could be abolished by overexpression of PAX6. (spandidos-publications.com)
- On the other hand, knocking down miR‑223 in GBM cells with antagomir significantly enhanced the inhibitory effect of TMZ on GBM cell proliferation and decreased the TMZ IC50, which could be abolished by knockdown of PAX6. (spandidos-publications.com)
- In conclusion, the present study demonstrated that TMZ inhibits GBM cell proliferation by inhibiting the expression of miR‑223, which leads to increased expression of tumor suppressor PAX6. (spandidos-publications.com)
- The present study aimed to investigate the potential interaction among TMZ, PAX6 and miRNAs in GBM cells and assess its impact on GBM cell proliferation for, to the best of our knowledge, the first time. (spandidos-publications.com)
- When JNK signalling pathway is blocked by inhibitor SP600125, hepatic stellate cells (HSCs) activation is inhibited, with less proliferation and reduced expression of α-smooth muscle actin (α-SMA) [ 15 ]. (biomedcentral.com)
- In platelets, it is involved in the generation of thromboxane A2 (TXA2), which promotes platelet activation and aggregation, vasoconstriction and proliferation of vascular smooth muscle cells. (drugbank.com)
- Unpredictably, cell cycle progression, cell proliferation and DNA synthesis were unaffected fol lowing NDRG1 expression. (scirp.org)
- Experiments with monoclonal antibodies against CD2 suggest that CD2 is the cell surface receptor for a natural ligand involved in T cell proliferation. (ox.ac.uk)
Overexpression2
- Overexpression of miR‑223 increases TMZ chemoresistance, while inhibition of miR‑223 with antagomir markedly decreases TMZ chemoresistance in GBM cells. (spandidos-publications.com)
- Small interfering RNA-mediated RKIP knockdown revealed similar effects as that of ectopic miR-27a expression, while overexpression of RKIP attenuated the function of miR-27a in lung adenocarcinoma cells. (biomedcentral.com)
MRNA11
- Expression of the oestrogen regulated pNR-2 mRNA in human breast cancer: relation to oestrogen receptor mRNA levels and response to tamoxifen therapy. (xenbase.org)
- Sequence of the pS2 mRNA induced by estrogen in the human breast cancer cell line MCF-7. (xenbase.org)
- Characterization of cDNA clones for human myeloperoxidase: predicted amino acid sequence and evidence for multiple mRNA species. (rusmedserv.com)
- miRNAs normally cleave mRNA by base-pairing to the 3′-untranslated region (UTR) of the target genes ( 9 ). (spandidos-publications.com)
- The neurological properties of N2a-Rα based on AhR activation were evaluated by immunohistochemical analysis of cytoskeletal molecules and by RT-PCR analysis of mRNA expression of neurotransmitter-production related molecules, such as tyrosine hydroxylase (TH). (biomedcentral.com)
- CYP1A1, a typical XRE-regulated gene, mRNA was induced without the application of ligand to the culture medium. (biomedcentral.com)
- N2a-Rα cells expressed tyrosine hydroxylase (TH) mRNA as a functional marker of catecholaminergic neurotransmitter production. (biomedcentral.com)
- MicroRNAs (miRNAs) are a class of small noncoding RNA molecules that negatively regulate the expression of target genes by either mRNA degradation or translational inhibition. (biomedcentral.com)
- CD2 mRNA was expressed in murine thymus and spleen, and in the T cell line EL4. (ox.ac.uk)
- The mRNA expression levels of TFFs were examined in the excised CRC specimens obtained from 154 consecutive CRC patients who underwent surgical resection between 2005 and 2007 at our institution. (spandidos-publications.com)
- In the present study, we evaluated the mRNA expression levels of TFF1, TFF2 and TFF3 in excised CRC specimens and assessed the correlation between TFF expression and the clinicopathological findings in CRC patients. (spandidos-publications.com)
Synthesis8
- However, the pathway downstream NDRG1, involving p21 and c8/18, regulating cell cycle progression and DNA synthesis is unfunctional. (scirp.org)
- RNA (1 g) was reversely transcribed to cDNA using the SuperScript III First-Strand Synthesis System (Invitrogen). (estme.org)
- Despite its biological importance, transfer RNA (tRNA) could not be adequately sequenced by Author Manuscript standard methods due to abundant post-transcriptional modifications and stable structure, which interfere with cDNA synthesis. (cdc.gov)
- Widely used RNA-seq methods start with adapter ligation and cDNA synthesis of biological RNA samples followed by PCR amplification to generate sequencing libraries1. (cdc.gov)
- Significant obstacles for the sequencing of tRNA include the presence of numerous post-transcriptional modifications and its stable and extensive secondary structure, which interfere with cDNA synthesis and adapter ligation. (cdc.gov)
- tRNAs are essential for cells and their synthesis is under stringent cellular control. (cdc.gov)
- Three specific modifications, N1-methyladenosine (m1A), N3-methylcytosine (m3C), and N1-methylguanosine (m1G), are abundant in eukaryotic tRNAs and are particularly problematic for reverse transcriptases (RTs) by causing cDNA synthesis to stop or misincorporate. (cdc.gov)
- Reverse-transcriptase enzyme was used to convert extracted RNA into cDNA using reverse transcriptase cDNA synthesis kit (MMLV RT 1st-Strand cDNA synthesis kit, Korea) following the protocol provided by the manufacturer. (bvsalud.org)
Tissues6
- Strong pS2 gene expression was also observed in the normal gastric mucosa and in the regenerative tissues surrounding ulcerous lesions of the gastrointestinal tract . (xenbase.org)
- CAMK2D was highly expressed in 70% of the human MMe tissues (56/80) and correlated with the loss of BAP1 expression, making it a potential diagnostic and therapeutic target for BAP1-deficient MMe. (mesothelioma-line.com)
- Increased miR-27a expression was also detected in tumor tissues sampled from lung adenocarcinoma patients treated with cisplatin-based chemotherapy and was proved to be correlated with low expression of RKIP, decreased sensitivity to cisplatin, and poor prognosis. (biomedcentral.com)
- C. Peterson, M. Ringne´r / Artificial Intelligence in Medicine 28 (2003) 59-74 structure and function, cellular metabolism, development of cells and tissues, and response of organisms to their environments. (lu.se)
- Since genes are composed of a given alphabet (A, T, C, G) with fixed pairing properties A-T and C-G, probes can be constructed that attract gene transcripts extracted from cell tissues and cultures. (lu.se)
- Stem cells from human exfoliated deciduous teeth (SHED) are multipotent stem cells derived from the pulp tissues of extracted deciduous teeth 1 . (bvsalud.org)
Functional8
- For the functional screening, Bcl2 - and Myc- expressing primary B cells were infected with a retroviral cDNA library. (haematologica.org)
- We identified CCND3 and NRAS as cooperative genes with Bcl2 and Myc through the functional screening. (haematologica.org)
- The study of functional synergism among cancer-causing genes is thus becoming one of the central issues in cancer research. (haematologica.org)
- Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium. (nih.gov)
- First, a full-length functional ZIKV cDNA clone was engineered as a bacterial artificial chromosome, with each reporter gene under the cap-independent translational control of a cardiovirus-derived internal ribosome entry site inserted downstream of the single open reading frame of the viral genome. (mdpi.com)
- 4. Yokoyama S, Imoto K, Kawamura T, Higashida H, Iwabe N, Miyata T, and Numa S (1989) Potassium channels from NG108-15 neuroblastoma-glioma hybrid cells: primary structure and functional expression from cDNAs. (aspetjournals.org)
- N2a-Rα cells exhibited two significant functional features. (biomedcentral.com)
- To address the question of specificity for the allele encoding the Na V 1.4-R669H variant as a cause of HypoPP and to produce a model system in which to characterize functional defects of the mutant channel and susceptibility to paralysis, we generated knockin mice carrying the ortholog of the gene encoding the Na V 1.4-R669H variant (referred to herein as R669H mice). (jci.org)
Characterization1
- Isolation and characterization of a cDNA clone for porcine thyroid peroxidase. (rusmedserv.com)
RNAi2
- Human GSAP CRISPR-Cas9 plasmid with gRNA targeting exon 16 (CATTGCCCTTTACAGTCATT) was design and cloned into PX459 by the Memorial Sloan Kettering Cancer Center (MSKCC) RNAi core facility. (estme.org)
- The activation of exogenous AhR in N2a-Rα cells was confirmed using RNAi, with si-AhR suppressing the expression of exogenous AhR. (biomedcentral.com)
Nucleotide Sequence2
- Derwahl M, Seto P, Rapoport B. Complete nucleotide sequence of the cDNA for thyroid peroxidase in FRTL5 rat thyroid cells. (rusmedserv.com)
- Nucleotide sequence of the cDNA encoding mouse thyroid peroxidase. (rusmedserv.com)
Localization2
- 9. Grissmer S, Dethlefs B, Wasmuth JJ, Goldin AL, Gutman GA, Cahalan MD, and Chandy KG (1990) Expression and chromosomal localization of a lymphocyte K + channel gene. (aspetjournals.org)
- Morphologically, N2a-Rα cells bore spontaneous neurites exhibiting axon-like properties with the localization of NF-H. In addition, cdc42 expression was increased in comparison to the control cell line. (biomedcentral.com)
Subsequently3
- Subsequently, the investigators identified a specific clone as containing pro-proliferative effects that was sensitive to neutralization by the soluble IL-21R. (intechopen.com)
- These clones are derived from fully-sequenced Mammalian Gene Collection (MGC) full-length cDNAs and subsequently cloned into a Gateway recombinational entry vector. (horizondiscovery.com)
- The barcodes for clones obtained from the previously performed steps in FateMap are amplified and, subsequently, sequenced to produce a cDNA library. (cbirt.net)
Vector4
- You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart. (genscript.com)
- The Center for Cancer Systems Biology of the Dana-Farber Institute created a collection of human open reading frames (ORFs) cloned into a Gateway-entry vector, known as the CCSB Human ORFeome Collection. (horizondiscovery.com)
- Furthermore, human cDNA of NDRG1 from normal placenta was cloned into a eukaryotic expression vector and transfected into the three cancer cell lines. (scirp.org)
- Mathematical Vector analysis implied a number of BAC-clones in tumor DNA with genes of potential importance for death or survival. (lu.se)
Regulation6
- The construction of this cell line is the first promising step in the regulation of GAL secretion from hTERT-immortalized BMSCs, and the potential application of this system may provide a stem cell-based research platform for pain. (hindawi.com)
- Chromosomal gene structure of human myeloperoxidase and regulation of its expression by granulocyte colony-stimulating factor. (rusmedserv.com)
- MicroRNAs (miRNAs) are small non-coding RNA molecules (containing ~22 nucleotides) that function in RNA silencing and post-transcriptional regulation of gene expression. (spandidos-publications.com)
- Our results directly illustrate the importance of GDH in the regulation of insulin secretion from pancreatic β-cells. (diabetesjournals.org)
- We propose that lcn2 is an autocrine mediator of reactive astrocytosis based on the multiple roles of lcn2 in the regulation of cell death, morphology, and migration of astrocytes. (jneurosci.org)
- Our results suggest that up-regulation of miR-27a could suppress RKIP expression and in turn contribute to chemoresistance of lung adenocarcinoma cells to cisplatin. (biomedcentral.com)
Variety of genes2
- 7 Importantly, it is believed that other hitherto unknown genes also play important roles in lymphomagenesis in addition to the synergistic effects of the aforementioned two oncogenes since human B-cell lymphomas often show a variety of genes subject to alterations and/or deregulated expression. (haematologica.org)
- XREs are found in the promoter region of a variety of genes. (biomedcentral.com)
Putative2
- We isolated mouse cDNA clones containing the entire coding region of the putative oncogene Akt2. (nih.gov)
- 1. McKinnon D (1989) Isolation of a cDNA clone coding for a putative second potassium channel indicates the existence of a gene family. (aspetjournals.org)
Vectors1
- These Gateway-adapted ORFs are ideal for easily moving gene content into compatible destination vectors for various proteomics studies. (horizondiscovery.com)
Endothelial5
- Evidence has been provided that activation of the vascular endothelial cells in the presence of the risk factors promotes oxidative stress and vascular inflammatory responses, leading to acceleration of atherosclerotic vascular disease. (frontiersin.org)
- K. Kokame, H. Kato and T. Miyata, "Homocysteine-Respondent Genes in Vascular Endothelial Cells Identified by Differential Display Analysis. (scirp.org)
- Platelet and endothelial cell adhesion molecule 1. (invivogen.com)
- The majority of VWF is synthesized by endothelial cells (ECs) and stored in Weibel-Palade bodies (WPB). (imperial.ac.uk)
- Background: A major clinical feature of severe coronavirus diease 2019 (COVID-19) is microvascular thrombosis linked to endothelial cell activation. (imperial.ac.uk)
Cellular4
- Using in situ hybridization, we show that although coexpressed in the fundus , the antrum and the antrum -pyloric regions of the stomach , the mouse pS2 and mSP genes exhibit distinct and complementary cellular patterns of expression. (xenbase.org)
- this limitation has been overcome via ectopic expression of human telomerase reverse transcriptase (hTERT), the catalytic component of telomerase, to produce large quantities of these cells as an attractive source for cellular transplantation [ 16 - 18 ]. (hindawi.com)
- In zebrafishes, forced expression of rat lcn2 gene increased the number and thickness of cellular processes in GFAP-expressing radial glia cells, suggesting that lcn2 expression in glia cells plays an important role in vivo . (jneurosci.org)
- These molecules control several aspects of neural cell life including axonal growth, cellular migration, and cell death, and therefore, are of increasing interest in the field of spinal cord injury (SCI). (bvsalud.org)
Homolog1
- Genetic alterations of BCL2 (B-cell CLL/lymphoma 2), MYC [v-myc myelocytomatosis viral oncogene homolog (avian)] and CCND1 (cyclin D1) are the most frequently found alterations in human B-cell lymphomas. (haematologica.org)
Phenotypes1
- The prin2.2 and csp41b-2 single mutants displayed pale phenotypes, abnormal chloroplasts with reduced transcript levels of photosynthesis genes and defects in embryo development. (frontiersin.org)
Accession2
- One clone ID might be correlated to multiple accession numbers, which share the same CDS sequence. (genscript.com)
- GenBank Accession Number AF 304351) in the transformed cells compared with the control cells. (cdc.gov)
Tumor supp1
- In general, TFF1 seems to function as a stomach-specific tumor suppressor gene ( 16 , 17 ), whereas TFF2 and TFF3 are thought to augment tumor progression by increasing tumor invasion and metastasis ( 16 , 18 ). (spandidos-publications.com)
Promoters1
- The PEP enzyme recognizes the -10 and -35 cis -elements, similar to those found in bacterial promoters whereas the NEP enzyme recognizes the YRTA-motif, which can also be found upstream of several genes with PEP promoters indicating that these genes can be transcribed by both polymerases ( Pfannschmidt and Liere, 2005 ). (frontiersin.org)
Genetic2
- Intense efforts to examine genetic alterations in human cancer have provided a catalogue of cancer-causing genes. (haematologica.org)
- Interestingly, no genetic foundation for cell diversity was observed within resistant clones. (cbirt.net)
Molecules7
- The use of human telomerase reverse transcriptase-immortalized bone marrow mesenchymal stromal cells (hTERT-BMSCs) as vehicles to deliver antinociceptive galanin (GAL) molecules into pain-processing centers represents a novel cell therapy strategy for pain management. (hindawi.com)
- The use of cell lines as "biological minipumps" to chronically deliver antinociceptive molecules into the pain-processing centers of the spinal cord represents a newly developed technique for the treatment of pain [ 3 ]. (hindawi.com)
- Thyroperoxidase, an auto-antigen with a mosaic structure made of nuclear and mitochondrial gene molecules. (rusmedserv.com)
- Inhibiting these molecules has been shown to increase neuroprotection, enhance axonal regeneration, and facilitate the implementation of cell replacement therapies. (bvsalud.org)
- This channel is activated by signalling molecules inside cells, called 'cyclic nucleotides', and its activity ultimately leads to calcium ions flowing into the sperm cell's tail. (elifesciences.org)
- RNA was reverse-transcribed to obtain the cDNA and then proceeded with PCR using specific primers for the Notch signaling pathway molecules (Notch1, Jagged-1, Jagged-2 and, Hes1) as well as stem cell marker (Nanog). (bvsalud.org)
- Knowledge on the expression analysis of Notch signaling pathway molecules in SHED cultured in KGM could highlight its involvement in controlling the biological activity of these stem cells, particularly during odontogenesis and other developmental process. (bvsalud.org)
Colorectal Cancer2
- Genome wide DNA alterations were evaluated by array CGH in addition to RNA expression profiling in colorectal cancer from patients with excellent and poor survival following primary operations. (lu.se)
- The genomic variation in colorectal cancer cells is tremendous and emphasizes that BAC array CGH is presently more powerful than available statistical models to discriminate DNA sequence information related to outcome. (lu.se)
Stem cells3
- Bone marrow stem cells, including the pluripotent hematopoietic stem cells (HSCs) and bone mesenchymal stem cells (BMSCs), are being considered as potential targets for cell and gene therapy-based approaches against a variety of different diseases. (hindawi.com)
- Indeed, the potent pathotropic migratory properties of BMSCs and ability to circumvent both the complications associated with immune rejection of allogenic cells and many of the moral reasons associated with embryonic stem cell use suggest that BMSCs are most promising stem cells as a potential target for the clinical use of genetically engineered stem cells [ 14 , 15 ]. (hindawi.com)
- Stem cells from human exfoliated deciduous teeth (SHED) (ALLCells, Alameda, CA, USA) were employed in the current study. (bvsalud.org)
Rodent2
- new nomenclature, gene organization, and divergence of human and rodent genes. (genscript.com)
- Fluorescence in situ hybridization of the mouse cDNA to rodent metaphase spreads demonstrated that the Akt2 gene maps to mouse chromosome band 7B1 and rat chromosome 1q22. (nih.gov)
Mammalian1
- The sphingomyelin that accumulates in the lysosomes of Niemann-Pick disease-affected cells is thought to arise from the degradation of the cells and their organelles because it is a major component of all mammalian cell membranes. (medscape.com)
19901
- 5. Chandy KG, Williams CB, Spencer RH, Aguilar BA, Ghanshani S, Tempel BL, and Gutman GA (1990) A family of three mouse potassium channel genes with intronless coding regions. (aspetjournals.org)
Eukaryotic1
- Chloroplasts, like mitochondria, evolved from free-living prokaryotic organisms that entered the eukaryotic cell through endosymbiosis. (frontiersin.org)
Antigen2
- The human T lymphocyte antigen CD2 (T11, sheep erythrocyte receptor) is expressed on all peripheral T cells and all but the most immature thymocytes. (ox.ac.uk)
- A rabbit antiserum raised against purified human CD2, precipitated from surface-labeled mouse thymocytes a glycoprotein of Mr 55,000-66,000 which decreased to Mr 35,000 on digestion with endo-beta-acetylglucosaminidase F. These sizes are consistent with those predicted for the murine CD2 antigen from the cDNA sequence. (ox.ac.uk)
Induces1
- CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells. (nih.gov)
Identification7
- Although the identification of other cooperative genes involved is important, our present understanding of such genes remains scant. (haematologica.org)
- Our new synergism-based method is useful for the identification of synergistic gene combinations in tumor development, and may expand our systemic understanding of a wide range of cancer-causing elements. (haematologica.org)
- 13 The identification and clarification of the multiple cooperative genes implicated in human lymphoma formation is important, although our present understanding of such genes remains scant. (haematologica.org)
- T. Okuda and H. Kondoh, "Identification of New Genes ndr2 and ndr3 Which Are Related to Ndr1/RTP/Drg1 but Show Distinct Tissue Specificity and Response to Nmyc," Biochemical and Biophysical Research Communications, Vol. 266, No. 1, 1999, pp. 208-215. (scirp.org)
- and the identification of KGF (FGF7), an epithelial cell specific growth factor. (acgtfoundation.org)
- 2. Kamb A, Weir M, Rudy B, Varmus H, and Kenyon C (1989) Identification of genes from pattern formation, tyrosine kinase, and potassium channel families by DNA amplification. (aspetjournals.org)
- An alternative approach to the identification of the murine homologue was to use cross-species DNA hybridization, employing human CD2 cDNA as a probe. (ox.ac.uk)
15,0001
- Known as the hORFeome v5.1, it contains over 15,000 individual clones representing over 12,000 unique genes. (horizondiscovery.com)
19912
- 7. Roberds SL and Tamkun MM (1991) Cloning and tissue-specific expression of five voltage-gated potassium channel cDNAs expressed in rat heart. (aspetjournals.org)
- 8. Paulmichl M, Nasmith P, Hellmiss R, Reed K, Boyle WA, Nerbonne JM, Peralta EG, and Clapham DE (1991) Cloning and expression of a rat cardiac delayed rectifier potassium channel. (aspetjournals.org)
Full-length2
- Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. (xenbase.org)
- The full length cDNAs for TIF3 and TEF-1d were cloned and sequenced. (cdc.gov)
Monoclonal1
- Levels of expression of breast epithelial mucin detected by monoclonal antibody BrE-3 in breast-cancer prognosis. (xenbase.org)
Mice2
- Mice homozygous for disruptions of this gene displace abnormalities of the immune system that are highly background sensitive. (jax.org)
- KN-93 significantly suppressed the tumor growth in mice xenografted with BAP1-deficient MMe cells. (mesothelioma-line.com)
Biological4
- However, we know less about the biological effects of IL-21 and its signaling mechanisms in leukemia cells and monocytes. (intechopen.com)
- In this chapter, we will focus on IL-21's biological effects and signaling pathways as well as discuss the potential implications and applications of IL-21 in leukemia cells. (intechopen.com)
- MicroRNAs (miRNAs) have been identified as important posttranscriptional regulators involved in various biological and pathological processes of cells, but their association with tumor chemoresistance has not been fully understood. (biomedcentral.com)
- To better understand the biological mechanisms of chemoresistance in lung adenocarcinoma cells and search for the reversion opportunities, we made use of a cisplatin-sensitive and derived resistant lung cancer cell line pair (A549 and A549/ CDDP). (biomedcentral.com)
Mantle cell lym2
- 8 - 12 Cases of CCND1/MYC double translocation are relatively frequent in mantle cell lymphoma. (haematologica.org)
- CD31/PECAM-1 impacts engraftment, growth and spread of mantle cell lymphoma cells and positively correlates with extramedullary involvement. (invivogen.com)
Metastasis4
- We detected miR-27a expression in two lung adenocarcinoma cell lines, A549 and A549/CDDP, and then investigated the effects of miR-27a on the metastasis and the chemosensitivity of cancer cells, using both gain- and loss-of-function studies. (biomedcentral.com)
- Therefore, chemotherapy-induced EMT in tumor cells has been linked to chemotherapeutic resistance and metastasis. (biomedcentral.com)
- TFF3 expression was significantly associated with the presence of distant metastasis (p=0.017), although neither TFF1 nor TFF2 expression was associated with the clinicopathological features. (spandidos-publications.com)
- A multivariate analysis revealed that the expression of TFF3, lymph node metastasis, and vascular invasion were independent prognostic factors for disease-specific survival. (spandidos-publications.com)
Chromosome2
Murine3
- The undifferentiated murine neuroblastoma Neuro2a cell line (ATCC) was stably transfected with AhR cDNA and the established cell line was named N2a-Rα. (biomedcentral.com)
- Clones encoding the murine homologue were isolated from a murine T helper cell cDNA library. (ox.ac.uk)
- The murine cDNA sequence encoded a predicted mature polypeptide of 322 amino acids that showed 54% identity with the predicted human sequence. (ox.ac.uk)
Induce2
- Our results suggest that lcn2 acts in an autocrine manner to induce cell death sensitization and morphological changes in astrocytes under inflammatory conditions and that these phenotypic changes may be the basis of reactive astrocytosis in vivo . (jneurosci.org)
- found that the expression of M, E, or N, in the absence of S, did not induce a neutralizing antibody response ( 15 ). (cdc.gov)