The Saccharomyces cerevisiae Sgs1p helicase localizes to the nucleolus and is required to maintain the integrity of the rDNA repeats. Sgs1p is a member of the RecQ DNA helicase family, which also includes Schizo-saccharomyces pombe Rqh1, and the human BLM and WRN genes. These genes encode proteins which are essential to maintenance of genomic integrity and which share a highly conserved helicase domain. Here we show that recombinant Sgs1p helicase efficiently unwinds guanine-guanine (G-G) paired DNA. Unwinding of G-G paired DNA is ATP- and Mg2+-dependent and requires a short 3' single-stranded tail. Strikingly, Sgs1p unwinds G-G paired substrates more efficiently than duplex DNAs, as measured either in direct assays or by competition experiments. Sgs1p efficiently unwinds G-G paired telomeric sequences, suggesting that one function of Sgs1p may be to prevent telomere-telomere interactions which can lead to chromosome non-disjunction. The rDNA is G-rich and has considerable potential for G-G pairing. Diminished ability to unwind G-G paired regions may also explain the deleterious effect of mutation of Sgs1 on rDNA stability, and the accelerated aging characteristic of yeast strains that lack Sgs1 as well as humans deficient in the related WRN helicase. (+info)
Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n.
(2/250)
Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism. (+info)
Werner syndrome helicase contains a 5'-->3' exonuclease activity that digests DNA and RNA strands in DNA/DNA and RNA/DNA duplexes dependent on unwinding.
(3/250)
We show that WRN helicase contains a unique 5'-->3' exonuclease activity in the N-terminal region. Adeletion mutant lacking 231 N-terminal amino acid residues, made in a baculovirus system, did nothave this activity, while it showed ATPase and DNA helicase activities. This exonuclease activity was co-precipitated with the helicase activity using monoclonal antibodies specific to WRN helicase, indicating that it is an integral component with WRN helicase. The exonuclease in WRN helicase does not digest free single-stranded DNA or RNA, but it digests a strand in the duplex DNA or an RNA strand in a RNA/DNA heteroduplex in a 5'-->3' direction dependent on duplex unwinding. The digestion products were identified as 5'-mononucleotides. Our data show that WRN helicase needs a single-stranded 3' overhang region for efficient binding and unwinding of duplex molecules, while blunt-ended or 5' overhang duplex molecules were hardly unwound. These findings suggest that the WRN helicase and integral 5'-->3' exonuclease activities are involved in preventing a hyper-recombination by resolving entangled structures of DNA and RNA/DNA heteroduplexes that may be generated during rep-lication, repair and/or transcription. (+info)
p53-mediated apoptosis is attenuated in Werner syndrome cells.
(4/250)
The WRN DNA helicase is a member of the DExH-containing DNA helicase superfamily that includes XPB, XPD, and BLM. Mutations in WRN are found in patients with the premature aging and cancer susceptibility syndrome known as Werner syndrome (WS). p53 binds to the WRN protein in vivo and in vitro through its carboxyl terminus. WS fibroblasts have an attenuated p53- mediated apoptotic response, and this deficiency can be rescued by expression of wild-type WRN. These data support the hypothesis that p53 can induce apoptosis through the modulation of specific DExH-containing DNA helicases and may have implications for the cancer predisposition observed in WS patients. (+info)
The Werner syndrome protein is involved in RNA polymerase II transcription.
(5/250)
Werner syndrome (WS) is a human progeroid syndrome characterized by the early onset of a large number of clinical features associated with the normal aging process. The complex molecular and cellular phenotypes of WS involve characteristic features of genomic instability and accelerated replicative senescence. The gene involved (WRN) was recently cloned, and its gene product (WRNp) was biochemically characterized as a helicase. Helicases play important roles in a variety of DNA transactions, including DNA replication, transcription, repair, and recombination. We have assessed the role of the WRN gene in transcription by analyzing the efficiency of basal transcription in WS lymphoblastoid cell lines that carry homozygous WRN mutations. Transcription was measured in permeabilized cells by [3H]UTP incorporation and in vitro by using a plasmid template containing the RNA polymerase II (RNA pol II)-dependent adenovirus major late promoter. With both of these approaches, we find that the transcription efficiency in different WS cell lines is reduced to 40-60% of the transcription in cells from normal individuals. This defect can be complemented by the addition of normal cell extracts to the chromatin of WS cells. Addition of purified wild-type WRNp but not mutated WRNp to the in vitro transcription assay markedly stimulates RNA pol II-dependent transcription carried out by nuclear extracts. A nonhelicase domain (a direct repeat of 27 amino acids) also appears to have a role in transcription enhancement, as revealed by a yeast hybrid-protein reporter assay. This is further supported by the lack of stimulation of transcription when mutant WRNp lacking this domain was added to the in vitro assay. We have thus used several approaches to show a role for WRNp in RNA pol II transcription, possibly as a transcriptional activator. A deficit in either global or regional transcription in WS cells may be a primary molecular defect responsible for the WS clinical phenotype. (+info)
Physical and functional interaction between p53 and the Werner's syndrome protein.
(6/250)
Werner's syndrome is a human autosomal recessive disorder leading to premature aging. The mutations responsible for this disorder have recently been localized to a gene (WRN) encoding a protein that possesses DNA helicase and exonuclease activities. Patients carrying WRN gene mutations exhibit an elevated rate of cancer, accompanied by increased genomic instability. The latter features are also characteristic of the loss of function of p53, a tumor suppressor that is very frequently inactivated in human cancer. Moreover, changes in the activity of p53 have been implicated in the onset of cellular replicative senescence. We report here that the WRN protein can form a specific physical interaction with p53. This interaction involves the carboxyl-terminal part of WRN and the extreme carboxyl terminus of p53, a region that plays an important role in regulating the functional state of p53. A small fraction of WRN can be found in complex with endogenous p53 in nontransfected cells. Overexpression of WRN leads to augmented p53-dependent transcriptional activity and induction of p21(Waf1) protein expression. These findings support the existence of a cross-talk between WRN and p53, which may be important for maintaining genomic integrity and for preventing the accumulation of aberrations that can give rise to premature senescence and cancer. (+info)
Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD.
(7/250)
While all known natural isolates of C. elegans contain multiple copies of the Tc1 transposon, which are active in the soma, Tc1 transposition is fully silenced in the germline of many strains. We mutagenized one such silenced strain and isolated mutants in which Tc1 had been activated in the germline ("mutators"). Interestingly, many other transposons of unrelated sequence had also become active. Most of these mutants are resistant to RNA interference (RNAi). We found one of the mutated genes, mut-7, to encode a protein with homology to RNaseD. This provides support for the notion that RNAi works by dsRNA-directed, enzymatic RNA degradation. We propose a model in which MUT-7, guided by transposon-derived dsRNA, represses transposition by degrading transposon-specific messengers, thus preventing transposase production and transposition. (+info)
Requirement of yeast SGS1 and SRS2 genes for replication and transcription.
(8/250)
The SGS1 gene of the yeast Saccharomyces cerevisiae encodes a DNA helicase with homology to the human Bloom's syndrome gene BLM and the Werner's syndrome gene WRN. The SRS2 gene of yeast also encodes a DNA helicase. Simultaneous deletion of SGS1 and SRS2 is lethal in yeast. Here, using a conditional mutation of SGS1, it is shown that DNA replication and RNA polymerase I transcription are drastically inhibited in the srs2Delta sgs1-ts strain at the restrictive temperature. Thus, SGS1 and SRS2 function in DNA replication and RNA polymerase I transcription. These functions may contribute to the various defects observed in Werner's and Bloom's syndromes. (+info)