(41/1299) Accumulation of collagen in ovarian benign tumours.

Extracellular matrix components of benign ovarian tumours (cystadenoma, adenofibroma, cystadenofibroma) were analysed. The investigated tumours contained twice as much collagen than control ovarian tissues. Significant alterations in mutual quantitative relationships between collagens of various types were observed. The proportion of type I collagen decreased and that of type III collagen increased. The accumulation of collagen was accompanied by a reduction in sulphated glycosaminoglycan content whereas the amount of hyaluronic acid was not changed. Dermatan sulphate was the most abundant glycosaminoglycan component. It is suggested that the accumulation of collagen (natural barrier to the migration of tumour cells) and underexpression of glycosaminoglycans/proteoglycans (binding some growth factors and interleukins) may exert an inhibitory effect on tumour growth.  (+info)

(42/1299) Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.  (+info)

(43/1299) Impaired elastic-fiber assembly by fibroblasts from patients with either Morquio B disease or infantile GM1-gangliosidosis is linked to deficiency in the 67-kD spliced variant of beta-galactosidase.

We have previously shown that intracellular trafficking and extracellular assembly of tropoelastin into elastic fibers is facilitated by the 67-kD elastin-binding protein identical to an enzymatically inactive, alternatively spliced variant of beta-galactosidase (S-Gal). In the present study, we investigated elastic-fiber assembly in cultures of dermal fibroblasts from patients with either Morquio B disease or GM1-gangliosidosis who bore different mutations of the beta-galactosidase gene. We found that fibroblasts taken from patients with an adult form of GM1-gangliosidosis and from patients with an infantile form, carrying a missense mutations in the beta-galactosidase gene-mutations that caused deficiency in lysosomal beta-galactosidase but not in S-Gal-assembled normal elastic fibers. In contrast, fibroblasts from two cases of infantile GM1-gangliosidosis that bear nonsense mutations of the beta-galactosidase gene, as well as fibroblasts from four patients with Morquio B who had mutations causing deficiency in both forms of beta-galactosidase, did not assemble elastic fibers. We also demonstrated that S-Gal-deficient fibroblasts from patients with either GM1-gangliosidosis or Morquio B can acquire the S-Gal protein, produced by coculturing of Chinese hamster ovary cells permanently transected with S-Gal cDNA, resulting in improved deposition of elastic fibers. The present study provides a novel and natural model validating functional roles of S-Gal in elastogenesis and elucidates an association between impaired elastogenesis and the development of connective-tissue disorders in patients with Morquio B disease and in patients with an infantile form of GM1-gangliosidosis.  (+info)

(44/1299) Virulence properties of motile aeromonads isolated from farmed frogs Rana tigerina and R. rugulosa.

Virulence factors were compared in Aeromonas species isolated from clinically normal and septicaemic farmed frogs from Thailand. Haemolysin activities against frog erythrocytes were significantly different within the collection of aeromonads. Groups of high haemolytic activity (unspeciated Aeromonas, Au), moderate haemolytic activity (A. hydrophila), and low haemolytic activity (A. veronii biovar sobria, A. veronii biovar veronii, A. caviae, A. schubertii) were noted. DNA colony hybridisation studies revealed that Au isolates possessed a haemolysin gene (ASH1) which was not present in any of the other Thai aeromonads or type strains tested. Elastinolytic activity was demonstrated in 90% of the Au isolates, 60% of the A. hydrophila isolates and in none of the other motile aeromonads. The cytotoxic activity of the Aeromonas isolates varied according to the source of cells used in the assays. Cells from rainbow trout were extremely sensitive to Au toxins but less so to toxins produced by other species. In contrast mammalian cells showed very little sensitivity to Au toxins but were more sensitive to toxins produced by A. hydrophila. Selection of suitable assay substrates is therefore important.  (+info)

(45/1299) Alpha(2)-antiplasmin gene deficiency in mice does not affect neointima formation after vascular injury.

The hypothesis that alpha(2)-antiplasmin (alpha(2)-AP), the main physiological plasmin inhibitor, plays a role in neointima formation was tested with use of a vascular injury model in wild-type (alpha(2)-AP(+/+)) and alpha(2)-AP-deficient (alpha(2)-AP(-/-)) mice. The neointimal and medial areas were similar 1 to 3 weeks after electric injury of the femoral artery in alpha(2)-AP(+/+) and alpha(2)-AP(-/-) mice, resulting in comparable intima/media ratios (eg, 0.43+/-0.12 and 0.42+/-0.11 2 weeks after injury). Nuclear cell counts in cross-sectional areas of the intima of the injured region were also comparable in arteries from alpha(2)-AP(+/+) and alpha(2)-AP(-/-) mice (78+/-19 and 69+/-8). Fibrin deposition was not significantly different in arteries of both genotypes 1 day after injury, and no mural thrombosis was detected 1 week after injury. Fibrinolytic activity in femoral arterial sections, as monitored by fibrin zymography, was higher in alpha(2)-AP(-/-) mice 1 week after injury (P<0.001) but was comparable in both genotypes 2 and 3 weeks after injury. Staining for elastin did not reveal significant degradation of the internal elastica lamina in either genotype. Immunocytochemical analysis revealed a comparable distribution pattern of alpha-actin-positive smooth muscle cells in both genotypes. These findings indicate that the endogenous fibrinolytic system of alpha(2)-AP(+/+) mice is capable of preventing fibrin deposition after vascular injury and suggest that alpha(2)-AP does not play a major role in smooth muscle cell migration and neointima formation in vivo.  (+info)

(46/1299) MEKC of desmosine and isodesmosine in urine of chronic destructive lung disease patients.

Degradation of extracellular matrix components is central to many pathological features of chronic destructive lung disorders. Desmosine and isodesmosine are elastin-derived cross-linked amino acids whose urine levels are considered representative of elastin breakdown. The aim of this study was to apply a novel methodology, based on high-performance capillary electrophoresis, to the quantification of desmosine and isodesmosine in 11 patients with stable chronic obstructive pulmonary disease (COPD), 10 with an exacerbation of COPD, nine with alpha1-antitrypsin deficiency, 13 with bronchiectasis, and 11 adults with cystic fibrosis, in comparison to 24 controls. It was found that, in patients with stable COPD, urinary desmosine levels were higher than in controls (p=0.03), but lower than in COPD subjects with an exacerbation (p< or =0.05). The highest desmosine levels were found in subjects with alpha1-antitrypsin deficiency, bronchiectasis and cystic fibrosis (p<0.001 versus stable COPD). In a short-term longitudinal study, five stable COPD patients showed a constant rate of desmosine excretion (mean coefficient of variation <8% over three consecutive days). In conclusion, the present method is simple and suitable for the determination of elastin-derived cross-linked amino acid excretion in urine, giving results similar to those obtained using other separation methods. In addition, evidence is presented that urinary desmosine excretion is increased in conditions characterized by airway inflammation, such as exacerbations of chronic obstructive pulmonary disease, bronchiectasis and cystic fibrosis. Results obtained in subjects with alphal-antitrypsin deficiency suggest that this method might be used to evaluate the putative efficacy of replacement therapy.  (+info)

(47/1299) Elastic and collagenous networks in vascular diseases.

Supravalvular aortic stenosis (SVAS), Marfan syndrome (MFS) and Ehlers-Danlos syndrome type IV (EDS IV) are three clinical entities characterized by vascular abnormalities that result from mutations of structural components of the extracellular matrix (ECM). Analyses of naturally occurring human mutations and of artificially generated deficiencies in the mouse have provided insights into the pathogenesis of these heritable disorders of the connective tissue. SVAS is associated with haploinsufficiency of elastin, one of the two major components of the elastic fibers. SVAS is characterized by narrowing of the arterial lumen due to the failure of regulation of cellular proliferation and matrix deposition. Mutations in fibrillin 1 are the cause of dissecting aneurysm leading to rupture of the ascending aorta. Fibrillin-1 is the building block of the microfibrils that span the entire thickness of the aortic wall and are a major component of the elastic fibers that reside in the medial layer. The vascular hallmark of EDS IV is rupture of large vessels. The phenotype is caused by mutations in type III collagen. The mutations ultimately affect the overall architecture of the collagenous network and the biomechanical properties of the adventitial layer of the vessel wall. Altogether, these genotype-phenotype correlations document the diversified contributions of distinct extracellular macroaggregates to the assembly and function of the vascular matrix.  (+info)

(48/1299) Effects of collagenase and elastase on the mechanical properties of lung tissue strips.

The dynamic stiffness (H), damping coefficient (G), and harmonic distortion (k(d)) characterizing tissue nonlinearity of lung parenchymal strips from guinea pigs were assessed before and after treatment with elastase or collagenase between 0.1 and 3.74 Hz. After digestion, data were obtained both at the same mean length and at the same mean force of the strip as before digestion. At the same mean length, G and H decreased by approximately 33% after elastase and by approximately 47% after collagenase treatment. At the same mean force, G and H increased by approximately 7% after elastase and by approximately 25% after collagenase treatment. The k(d) increased more after collagenase (40%) than after elastase (20%) treatment. These findings suggest that, after digestion, the fraction of intact fibers decreases, which, at the same mean length, leads to a decrease in moduli. At the same mean force, collagen fibers operate at a higher portion of their stress-strain curve, which results in an increase in moduli. Also, G and H were coupled so that hysteresivity (G/H) did not change after treatments. However, k(d) was decoupled from elasticity and was sensitive to stretching of collagen, which may be of value in detecting structural alterations in the connective tissue of the lung.  (+info)