A species of SEA URCHINS in the family Strongylocentrotidae found on the Pacific coastline from Alaska to Mexico. This species serves as a major research model for molecular developmental biology and other fields.
Somewhat flattened, globular echinoderms, having thin, brittle shells of calcareous plates. They are useful models for studying FERTILIZATION and EMBRYO DEVELOPMENT.
A genus of SEA URCHINS in the family Strongylocentrotidae. They possess more than three pore pairs per ambulacral plate. The species STRONGYLOCENTROTUS PURPURATUS is commonly used for research.
A mature haploid female germ cell extruded from the OVARY at OVULATION.
A phylum of the most familiar marine invertebrates. Its class Stelleroidea contains two subclasses, the Asteroidea (the STARFISH or sea stars) and the Ophiuroidea (the brittle stars, also called basket stars and serpent stars). There are 1500 described species of STARFISH found throughout the world. The second class, Echinoidea, contains about 950 species of SEA URCHINS, heart urchins, and sand dollars. A third class, Holothuroidea, comprises about 900 echinoderms known as SEA CUCUMBERS. Echinoderms are used extensively in biological research. (From Barnes, Invertebrate Zoology, 5th ed, pp773-826)
The fusion of a spermatozoon (SPERMATOZOA) with an OVUM thus resulting in the formation of a ZYGOTE.
The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.
A superfamily of strongyles or roundworms which are parasites in the intestinal tract of equines, pigs, rodents, and primates (including man). It includes the genera Cyasthostomum, Ransomus, Globocephalus, OESOPHAGOSTOMUM, and STRONGYLUS.
An early non-mammalian embryo that follows the MORULA stage. A blastula resembles a hollow ball with the layer of cells surrounding a fluid-filled cavity (blastocele). The layer of cells is called BLASTODERM.
A clear, homogenous, structureless, eosinophilic substance occurring in pathological degeneration of tissues.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The outer of the three germ layers of an embryo.
The posterior filiform portion of the spermatozoon (SPERMATOZOA) that provides sperm motility.
Mature male germ cells derived from SPERMATIDS. As spermatids move toward the lumen of the SEMINIFEROUS TUBULES, they undergo extensive structural changes including the loss of cytoplasm, condensation of CHROMATIN into the SPERM HEAD, formation of the ACROSOME cap, the SPERM MIDPIECE and the SPERM TAIL that provides motility.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.
The developmental stage that follows BLASTULA or BLASTOCYST. It is characterized by the morphogenetic cell movements including invagination, ingression, and involution. Gastrulation begins with the formation of the PRIMITIVE STREAK, and ends with the formation of three GERM LAYERS, the body plan of the mature organism.
Interactive processes between the oocyte (OVUM) and the sperm (SPERMATOZOA) including sperm adhesion, ACROSOME REACTION, sperm penetration of the ZONA PELLUCIDA, and events leading to FERTILIZATION.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The relationships of groups of organisms as reflected by their genetic makeup.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Proteins which are found in eggs (OVA) from any species.
Wormlike or grublike stage, following the egg in the life cycle of insects, worms, and other metamorphosing animals.
The cap-like structure covering the anterior portion of SPERM HEAD. Acrosome, derived from LYSOSOMES, is a membrane-bound organelle that contains the required hydrolytic and proteolytic enzymes necessary for sperm penetration of the egg in FERTILIZATION.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
The fertilized OVUM resulting from the fusion of a male and a female gamete.
A microtubule subunit protein found in large quantities in mammalian brain. It has also been isolated from SPERM FLAGELLUM; CILIA; and other sources. Structurally, the protein is a dimer with a molecular weight of approximately 120,000 and a sedimentation coefficient of 5.8S. It binds to COLCHICINE; VINCRISTINE; and VINBLASTINE.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Small chromosomal proteins (approx 12-20 kD) possessing an open, unfolded structure and attached to the DNA in cell nuclei by ionic linkages. Classification into the various types (designated histone I, histone II, etc.) is based on the relative amounts of arginine and lysine in each.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
The inner of the three germ layers of an embryo.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Nucleic acid sequences involved in regulating the expression of genes.
The salinated water of OCEANS AND SEAS that provides habitat for marine organisms.
A post-MORULA preimplantation mammalian embryo that develops from a 32-cell stage into a fluid-filled hollow ball of over a hundred cells. A blastocyst has two distinctive tissues. The outer layer of trophoblasts gives rise to extra-embryonic tissues. The inner cell mass gives rise to the embryonic disc and eventual embryo proper.
The sum of the weight of all the atoms in a molecule.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
The middle germ layer of an embryo derived from three paired mesenchymal aggregates along the neural tube.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Large, robust forms of brown algae (PHAEOPHYCEAE) in the order Laminariales. They are a major component of the lower intertidal and sublittoral zones on rocky coasts in temperate and polar waters. Kelp, a kind of SEAWEED, usually refers to species in the genera LAMINARIA or MACROCYSTIS, but the term may also be used for species in FUCUS or Nereocystis.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.
The flow of water in enviromental bodies of water such as rivers, oceans, water supplies, aquariums, etc. It includes currents, tides, and waves.

Revisiting the role of H+ in chemotactic signaling of sperm. (1/130)

Chemotaxis of sperm is an important step toward fertilization. During chemotaxis, sperm change their swimming behavior in a gradient of the chemoattractant that is released by the eggs, and finally sperm accumulate near the eggs. A well established model to study chemotaxis is the sea urchin Arbacia punctulata. Resact, the chemoattractant of Arbacia, is a peptide that binds to a receptor guanylyl cyclase. The signaling pathway underlying chemotaxis is still poorly understood. Stimulation of sperm with resact induces a variety of cellular events, including a rise in intracellular pH (pHi) and an influx of Ca2+; the Ca2+ entry is essential for the chemotactic behavior. Previous studies proposed that the influx of Ca2+ is initiated by the rise in pHi. According to this proposal, a cGMP-induced hyperpolarization activates a voltage-dependent Na+/H+ exchanger that expels H+ from the cell. Because some aspects of the proposed signaling pathway are inconsistent with recent results (Kaupp, U.B., J. Solzin, J.E. Brown, A. Helbig, V. Hagen, M. Beyermann, E. Hildebrand, and I. Weyand. 2003. Nat. Cell Biol. 5:109-117), we reexamined the role of protons in chemotaxis of sperm using kinetic measurements of the changes in pHi and intracellular Ca2+ concentration. We show that for physiological concentrations of resact (<25 pM), the influx of Ca2+ precedes the rise in pHi. Moreover, buffering of pHi completely abolishes the resact-induced pHi signal, but leaves the Ca2+ signal and the chemotactic motor response unaffected. We conclude that an elevation of pHi is required neither to open Ca(2+)-permeable channels nor to control the chemotactic behavior. Intracellular release of cGMP from a caged compound does not cause an increase in pHi, indicating that the rise in pHi is induced by cellular events unrelated to cGMP itself, but probably triggered by the consumption and subsequent replenishment of GTP. These results show that the resact-induced rise in pHi is not an obligatory step in sperm chemotactic signaling. A rise in pHi is also not required for peptide-induced Ca2+ entry into sperm of the sea urchin Strongylocentrotus purpuratus. Speract, a peptide of S. purpuratus may act as a chemoattractant as well or may serve functions other than chemotaxis.  (+info)

Sphedgehog is expressed by pigment cell precursors during early gastrulation in Strongylocentrotus purpuratus. (2/130)

We have sequenced the Sphedgehog (Sphh) gene from the sea urchin Strongylocentrotus purpuratus. Sphh transcripts are detected first at the mesenchyme blastula stage, and they accumulate throughout early embryogenesis. The Sphh protein is produced by precursor pigment cells during early and midgastrulation. NiCl2 inhibits pigment cell differentiation in sea urchins. Here, we show that, in S. purpuratus, nickel affects a process(es) between 17 and 24 hr of development, corresponding to the time period when Sphh mRNA is first detected. However, nickel treatment does not alter the early expression of Sphh.  (+info)

The oxidative burst at fertilization is dependent upon activation of the dual oxidase Udx1. (3/130)

The sea urchin egg is a quiescent cell...until fertilization, when the egg is activated. The classic respiratory burst at fertilization is the result of prodigious hydrogen peroxide production, but the mechanism for this synthesis is not known. Here we quantitate the kinetics of hydrogen peroxide synthesis at a single-cell level using an imaging photon detector, showing that 60 nM hydrogen peroxide accumulates within the perivitelline space of each zygote. We find that the NADPH oxidation activity is enriched at the cell surface and is sensitive to a pharmacological inhibitor of NADPH oxidase enzymes. Finally, we show that a sea urchin dual oxidase homolog, Udx1, is responsible for generating the hydrogen peroxide necessary for the physical block to polyspermy. Phylogenetic analysis of the enzymatic modules in Udx1 suggests a potentially conserved role for the dual oxidase family in hydrogen peroxide production and regulation during fertilization.  (+info)

Activation of multidrug efflux transporter activity at fertilization in sea urchin embryos (Strongylocentrotus purpuratus). (4/130)

This study presents functional and molecular evidence for acquisition of multidrug transporter-mediated efflux activity as a consequence of fertilization in the sea urchin. Sea urchin eggs and embryos express low levels of efflux transporter genes with homology to the multidrug resistance associated protein (mrp) and permeability glycoprotein (p-gp) families of ABC transporters. The corresponding efflux activity is low in unfertilized eggs but is dramatically upregulated within 25 min of fertilization; the expression of this activity does not involve de novo gene expression and is insensitive to inhibitors of transcription and translation indicating activation of pre-existing transporter protein. Our study, using specific inhibitors of efflux transporters, indicates that the major activity is from one or more mrp-like transporters. The expression of activity at fertilization requires microfilaments, suggesting that the transporters are in vesicles and moved to the surface after fertilization. Pharmacological inhibition of mrp-mediated efflux activity with MK571 sensitizes embryos to the toxic compound vinblastine, confirming that one role for the efflux transport activity is embryo protection from xenobiotics. In addition, inhibition of mrp activity with MK571 alone retards mitosis indicating that mrp-like activity may also be required for early cell divisions.  (+info)

Sea urchin vault structure, composition, and differential localization during development. (5/130)

BACKGROUND: Vaults are intriguing ribonucleoprotein assemblies with an unknown function that are conserved among higher eukaryotes. The Pacific coast sea urchin, Strongylocentrotus purpuratus, is an invertebrate model organism that is evolutionarily closer to humans than Drosophila and C. elegans, neither of which possesses vaults. Here we compare the structures of sea urchin and mammalian vaults and analyze the subcellular distribution of vaults during sea urchin embryogenesis. RESULTS: The sequence of the sea urchin major vault protein (MVP) was assembled from expressed sequence tags and genome traces, and the predicted protein was found to have 64% identity and 81% similarity to rat MVP. Sea urchin MVP includes seven approximately 50 residue repeats in the N-terminal half of the protein and a predicted coiled coil domain in the C-terminus, as does rat MVP. A cryoelectron microscopy (cryoEM) reconstruction of isolated sea urchin vaults reveals the assembly to have a barrel-shaped external structure that is nearly identical to the rat vault structure. Analysis of the molecular composition of the sea urchin vault indicates that it contains components that may be homologs of the mammalian vault RNA component (vRNA) and protein components (VPARP and TEP1). The sea urchin vault appears to have additional protein components in the molecular weight range of 14-55 kDa that might correspond to molecular contents. Confocal experiments indicate a dramatic relocalization of MVP from the cytoplasm to the nucleus during sea urchin embryogenesis. CONCLUSIONS: These results are suggestive of a role for the vault in delivering macromolecules to the nucleus during development.  (+info)

A dual-fluorescence reporter system for high-throughput clone characterization and selection by cell sorting. (6/130)

Molecular biology critically depends upon the isolation of desired DNA sequences. Flow cytometry, with its capacity to interrogate and sort more than 50,000 cells/s, shows great potential to expedite clone characterization and isolation. Intrinsic heterogeneity of protein expression levels in cells limits the utility of single fluorescent reporters for cell-sorting. Here, we report a novel dual-fluorescence strategy that overcomes the inherent limitations of single reporter systems by controlling for expression variability. We demonstrate a dual-reporter system using the green fluorescent protein (GFP) gene fused to the Discosoma red fluorescent protein (DsRed) gene. The system reports the successful insertion of foreign DNA with the loss of DsRed fluorescence and the maintenance of GFP fluorescence. Single cells containing inserts are readily recognized by their altered ratios of green to red fluorescence and separated using a high-speed cell-sorter for further processing. This novel reporter system and vector were successfully validated by shotgun library construction, cloned sequence isolation, PCR amplification and DNA sequencing of cloned inserts from bacteria after cell-sorting. This simple, robust system can also be adapted for diverse biosensor assays and is amenable to miniaturization. We demonstrated that dual-fluorescence reporting coupled with high-speed cell-sorting provides a more efficient alternative to traditional methods of clone isolation.  (+info)

Gene regulatory networks for development. (7/130)

The genomic program for development operates primarily by the regulated expression of genes encoding transcription factors and components of cell signaling pathways. This program is executed by cis-regulatory DNAs (e.g., enhancers and silencers) that control gene expression. The regulatory inputs and functional outputs of developmental control genes constitute network-like architectures. In this PNAS Special Feature are assembled papers on developmental gene regulatory networks governing the formation of various tissues and organs in nematodes, flies, sea urchins, frogs, and mammals. Here, we survey salient points of these networks, by using as reference those governing specification of the endomesoderm in sea urchin embryos and dorsal-ventral patterning in the Drosophila embryo.  (+info)

Strongylocentrotus purpuratus transcription factor GATA-E binds to and represses transcription at an Otx-Goosecoid cis-regulatory element within the aboral ectoderm-specific spec2a enhancer. (8/130)

During Strongylocentrotus purpuratus embryogenesis, aboral ectoderm-specific expression of spec2a relies on an upstream enhancer that confers its spatial specificity largely through repression. The purpose of this study was to determine how spec2a expression is repressed in endoderm and oral ectoderm territories. A 78-base pair DNA sequence within the enhancer contains five tightly spaced cis-regulatory elements including proximal (TAATCT) and distal (TAATCC) elements that bind to both SpOtx, a broadly distributed transcriptional activator, and SpGoosecoid (SpGsc), an oral ectoderm-restricted transcriptional repressor. We show here that these two seemingly redundant Otx/Gsc elements have distinct functions. The proximal element bound to SpGATA-E, an endomesoderm-specific transcription factor. Treatment with SpGATA-E and SpGsc morpholino antisense oligonucleotides (MASOs) resulted in enhanced transcriptional activity from the proximal element, suggesting that both factors functioned as repressors at this site. SpGATA-E MASO-treated embryos failed to express ectoderm markers, indicating a role for SpGATA-E in ectoderm differentiation. The spec2a proximal element was distinct from the corresponding element in the related spec1 enhancer, and swaps between spec1 and spec2a cis-regulatory elements indicated, that for optimal repression, the proximal element had to interact with a nearby CCAAT-binding factor element. Our results show that the recently evolved proximal element contributes to the repression of spec2a in endomesoderm and oral ectoderm territories.  (+info)

I apologize for any confusion, but "Strongylocentrotus purpuratus" is not a medical term. It is the scientific name for a species of sea urchin that is often used in biological research. The purple sea urchin, as it is commonly known, is native to the Pacific coast of North America and is widely studied in developmental biology, genetics, and evolution due to its simple and well-understood anatomy.

I'm happy to help! However, it seems there might be a bit of confusion here. "Sea urchins" is a common name that refers to a type of marine invertebrate animal, typically characterized by their round, spiny shells. They belong to the class Echinoidea within the phylum Echinodermata.

Medically speaking, there isn't a specific definition for "sea urchins." However, if you come into contact with sea urchins while swimming or diving and accidentally step on them, their spines can puncture your skin and potentially cause an infection. In this case, medical attention may be necessary to remove the embedded spines and treat any resulting infection.

If you were referring to a specific medical term related to sea urchins, could you please clarify? I'm here to help!

"Strongylocentrotus" is not a medical term, but a genus name in the phylum Echinodermata, which includes sea urchins. The most common species included in this genus are Strongylocentrotus droebachiensis (Green Sea Urchin) and Strongylocentrotus franciscanus (Purple Sea Urchin). These species have been used in some medical research due to their biochemical properties, but they are not typically associated with human diseases or conditions.

An ovum is the female reproductive cell, or gamete, produced in the ovaries. It is also known as an egg cell and is released from the ovary during ovulation. When fertilized by a sperm, it becomes a zygote, which can develop into a fetus. The ovum contains half the genetic material necessary to create a new individual.

Echinodermata is a phylum in the animal kingdom that includes various marine organisms such as sea stars, sea urchins, sand dollars, brittle stars, and sea cucumbers. The name Echinodermata comes from the Greek words "echinos," meaning spiny, and "derma," meaning skin, which refers to the characteristic spiny skin of many echinoderms.

Echinoderms are bilaterally symmetrical as larvae but become radially symmetrical as adults, with their bodies organized around a central axis. They have a unique water vascular system that helps them move and respire, and most species have specialized structures called pedicellariae that help them clean and defend themselves.

Echinoderms are also known for their ability to regenerate lost body parts, and some species can even undergo asexual reproduction through fragmentation. They play important ecological roles in marine ecosystems, including grazing on algae and other organisms, breaking down organic matter, and serving as prey for larger animals.

Fertilization is the process by which a sperm cell (spermatozoon) penetrates and fuses with an egg cell (ovum), resulting in the formation of a zygote. This fusion of genetic material from both the male and female gametes initiates the development of a new organism. In human biology, fertilization typically occurs in the fallopian tube after sexual intercourse, when a single sperm out of millions is able to reach and penetrate the egg released from the ovary during ovulation. The successful fusion of these two gametes marks the beginning of pregnancy.

A nonmammalian embryo refers to the developing organism in animals other than mammals, from the fertilized egg (zygote) stage until hatching or birth. In nonmammalian species, the developmental stages and terminology differ from those used in mammals. The term "embryo" is generally applied to the developing organism up until a specific stage of development that is characterized by the formation of major organs and structures. After this point, the developing organism is referred to as a "larva," "juvenile," or other species-specific terminology.

The study of nonmammalian embryos has played an important role in our understanding of developmental biology and evolutionary developmental biology (evo-devo). By comparing the developmental processes across different animal groups, researchers can gain insights into the evolutionary origins and diversification of body plans and structures. Additionally, nonmammalian embryos are often used as model systems for studying basic biological processes, such as cell division, gene regulation, and pattern formation.

Strongyloidea is a superfamily of parasitic nematode (roundworm) worms that includes several medically important genera such as Strongyloides and Rhabditis. These parasites are known to infect humans and other animals, causing a variety of symptoms depending on the species and the location of the infection in the body.

The genus Strongyloides contains several species that can infect humans, including S. stercoralis, S. fuelleborni, and S. kellyi. These parasites are known to cause strongyloidiasis, a disease characterized by gastrointestinal symptoms such as abdominal pain, diarrhea, and bloating, as well as skin rashes and respiratory symptoms in some cases.

The life cycle of Strongyloides species is complex and involves both free-living and parasitic stages. The worms can infect humans through contact with contaminated soil or water, and can then reproduce within the human body, causing ongoing infection and potentially serious complications if left untreated.

Treatment for strongyloidiasis typically involves administration of anti-parasitic drugs such as ivermectin or albendazole, which can help to eliminate the infection and prevent further transmission.

A blastula is a stage in the early development of many animals, including mammals. It is a hollow ball of cells that forms as a result of cleavage, which is the process of cell division during embryonic development. The blastula is typically characterized by the presence of a fluid-filled cavity called the blastocoel, which is surrounded by a single layer of cells known as the blastoderm.

In mammals, the blastula stage follows the morula stage, which is a solid mass of cells that results from cleavage of the fertilized egg. During further cell division and rearrangement, the cells in the morula become organized into an inner cell mass and an outer layer of cells, called the trophoblast. The inner cell mass will eventually give rise to the embryo proper, while the trophoblast will contribute to the formation of the placenta.

As the morula continues to divide and expand, it forms a cavity within the inner cell mass, which becomes the blastocoel. The single layer of cells surrounding the blastocoel is called the blastoderm. At this stage, the blastula is capable of further development through a process called gastrulation, during which the three germ layers of the embryo (ectoderm, mesoderm, and endoderm) are formed.

It's important to note that not all animals go through a blastula stage in their development. Some animals, such as insects and nematodes, have different patterns of early development that do not include a blastula stage.

'Hyalin' is not a medical condition or disease, but rather a histological term used to describe a particular type of tissue structure. Hyalin refers to the homogeneous, translucent, and eosinophilic (pink) appearance of a tissue under a microscope due to the accumulation of an amorphous, acellular, and protein-rich matrix.

Hyalinization can occur in various tissues, including blood vessels, cardiac valves, cartilage, and other connective tissues. It is often associated with aging, injury, inflammation, or degenerative changes, such as those seen in hyaline membrane disease (a respiratory disorder in premature infants) or hypertrophic cardiomyopathy (thickening of the heart muscle).

In summary, Hyalin is a histological term used to describe the appearance of tissue under a microscope due to the accumulation of an amorphous, acellular, and protein-rich matrix.

Molecular sequence data refers to the specific arrangement of molecules, most commonly nucleotides in DNA or RNA, or amino acids in proteins, that make up a biological macromolecule. This data is generated through laboratory techniques such as sequencing, and provides information about the exact order of the constituent molecules. This data is crucial in various fields of biology, including genetics, evolution, and molecular biology, allowing for comparisons between different organisms, identification of genetic variations, and studies of gene function and regulation.

Ectoderm is the outermost of the three primary germ layers in a developing embryo, along with the endoderm and mesoderm. The ectoderm gives rise to the outer covering of the body, including the skin, hair, nails, glands, and the nervous system, which includes the brain, spinal cord, and peripheral nerves. It also forms the lining of the mouth, anus, nose, and ears. Essentially, the ectoderm is responsible for producing all the epidermal structures and the neural crest cells that contribute to various derivatives such as melanocytes, adrenal medulla, smooth muscle, and peripheral nervous system components.

The "sperm tail" is also known as the flagellum, which is a whip-like structure that enables the sperm to move or swim through fluid. The human sperm tail is made up of nine microtubule doublets and a central pair of microtubules, which are surrounded by a mitochondrial sheath that provides energy for its movement. This complex structure allows the sperm to navigate through the female reproductive tract in order to reach and fertilize an egg.

Spermatozoa are the male reproductive cells, or gametes, that are produced in the testes. They are microscopic, flagellated (tail-equipped) cells that are highly specialized for fertilization. A spermatozoon consists of a head, neck, and tail. The head contains the genetic material within the nucleus, covered by a cap-like structure called the acrosome which contains enzymes to help the sperm penetrate the female's egg (ovum). The long, thin tail propels the sperm forward through fluid, such as semen, enabling its journey towards the egg for fertilization.

A base sequence in the context of molecular biology refers to the specific order of nucleotides in a DNA or RNA molecule. In DNA, these nucleotides are adenine (A), guanine (G), cytosine (C), and thymine (T). In RNA, uracil (U) takes the place of thymine. The base sequence contains genetic information that is transcribed into RNA and ultimately translated into proteins. It is the exact order of these bases that determines the genetic code and thus the function of the DNA or RNA molecule.

Developmental gene expression regulation refers to the processes that control the activation or repression of specific genes during embryonic and fetal development. These regulatory mechanisms ensure that genes are expressed at the right time, in the right cells, and at appropriate levels to guide proper growth, differentiation, and morphogenesis of an organism.

Developmental gene expression regulation is a complex and dynamic process involving various molecular players, such as transcription factors, chromatin modifiers, non-coding RNAs, and signaling molecules. These regulators can interact with cis-regulatory elements, like enhancers and promoters, to fine-tune the spatiotemporal patterns of gene expression during development.

Dysregulation of developmental gene expression can lead to various congenital disorders and developmental abnormalities. Therefore, understanding the principles and mechanisms governing developmental gene expression regulation is crucial for uncovering the etiology of developmental diseases and devising potential therapeutic strategies.

A gastrula is a stage in the early development of many animals, including humans, that occurs following fertilization and cleavage of the zygote. During this stage, the embryo undergoes a process called gastrulation, which involves a series of cell movements that reorganize the embryo into three distinct layers: the ectoderm, mesoderm, and endoderm. These germ layers give rise to all the different tissues and organs in the developing organism.

The gastrula is characterized by the presence of a central cavity called the archenteron, which will eventually become the gut or gastrointestinal tract. The opening of the archenteron is called the blastopore, which will give rise to either the mouth or anus, depending on the animal group.

In summary, a gastrula is a developmental stage in which an embryo undergoes gastrulation to form three germ layers and a central cavity, which will eventually develop into various organs and tissues of the body.

Sperm-ovum interactions, also known as sperm-egg interactions, refer to the specific series of events that occur between a spermatozoon (sperm) and an oocyte (egg or ovum) during fertilization in sexual reproduction.

The process begins with the sperm's attachment to the zona pellucida, a glycoprotein layer surrounding the oocyte. This interaction is mediated by specific proteins on the surface of both the sperm and the zona pellucida. Following attachment, the sperm undergoes the acrosome reaction, during which enzymes are released from the sperm's head to help digest and penetrate the zona pellucida.

Once the sperm has successfully traversed the zona pellucida, it makes contact with the oocyte's plasma membrane, triggering the fusion of the sperm and egg membranes. This results in the release of the sperm's genetic material into the oocyte's cytoplasm and the initiation of a series of intracellular signaling events within the oocyte that ultimately lead to its completion of meiosis II and formation of a zygote, marking the beginning of embryonic development.

Proper sperm-ovum interactions are crucial for successful fertilization and subsequent embryonic development, and any disruptions in these processes can result in infertility or early pregnancy loss.

An amino acid sequence is the specific order of amino acids in a protein or peptide molecule, formed by the linking of the amino group (-NH2) of one amino acid to the carboxyl group (-COOH) of another amino acid through a peptide bond. The sequence is determined by the genetic code and is unique to each type of protein or peptide. It plays a crucial role in determining the three-dimensional structure and function of proteins.

Phylogeny is the evolutionary history and relationship among biological entities, such as species or genes, based on their shared characteristics. In other words, it refers to the branching pattern of evolution that shows how various organisms have descended from a common ancestor over time. Phylogenetic analysis involves constructing a tree-like diagram called a phylogenetic tree, which depicts the inferred evolutionary relationships among organisms or genes based on molecular sequence data or other types of characters. This information is crucial for understanding the diversity and distribution of life on Earth, as well as for studying the emergence and spread of diseases.

A gene is a specific sequence of nucleotides in DNA that carries genetic information. Genes are the fundamental units of heredity and are responsible for the development and function of all living organisms. They code for proteins or RNA molecules, which carry out various functions within cells and are essential for the structure, function, and regulation of the body's tissues and organs.

Each gene has a specific location on a chromosome, and each person inherits two copies of every gene, one from each parent. Variations in the sequence of nucleotides in a gene can lead to differences in traits between individuals, including physical characteristics, susceptibility to disease, and responses to environmental factors.

Medical genetics is the study of genes and their role in health and disease. It involves understanding how genes contribute to the development and progression of various medical conditions, as well as identifying genetic risk factors and developing strategies for prevention, diagnosis, and treatment.

A genome is the complete set of genetic material (DNA, or in some viruses, RNA) present in a single cell of an organism. It includes all of the genes, both coding and noncoding, as well as other regulatory elements that together determine the unique characteristics of that organism. The human genome, for example, contains approximately 3 billion base pairs and about 20,000-25,000 protein-coding genes.

The term "genome" was first coined by Hans Winkler in 1920, derived from the word "gene" and the suffix "-ome," which refers to a complete set of something. The study of genomes is known as genomics.

Understanding the genome can provide valuable insights into the genetic basis of diseases, evolution, and other biological processes. With advancements in sequencing technologies, it has become possible to determine the entire genomic sequence of many organisms, including humans, and use this information for various applications such as personalized medicine, gene therapy, and biotechnology.

Molecular cloning is a laboratory technique used to create multiple copies of a specific DNA sequence. This process involves several steps:

1. Isolation: The first step in molecular cloning is to isolate the DNA sequence of interest from the rest of the genomic DNA. This can be done using various methods such as PCR (polymerase chain reaction), restriction enzymes, or hybridization.
2. Vector construction: Once the DNA sequence of interest has been isolated, it must be inserted into a vector, which is a small circular DNA molecule that can replicate independently in a host cell. Common vectors used in molecular cloning include plasmids and phages.
3. Transformation: The constructed vector is then introduced into a host cell, usually a bacterial or yeast cell, through a process called transformation. This can be done using various methods such as electroporation or chemical transformation.
4. Selection: After transformation, the host cells are grown in selective media that allow only those cells containing the vector to grow. This ensures that the DNA sequence of interest has been successfully cloned into the vector.
5. Amplification: Once the host cells have been selected, they can be grown in large quantities to amplify the number of copies of the cloned DNA sequence.

Molecular cloning is a powerful tool in molecular biology and has numerous applications, including the production of recombinant proteins, gene therapy, functional analysis of genes, and genetic engineering.

Egg proteins, also known as egg white proteins or ovalbumin, refer to the proteins found in egg whites. There are several different types of proteins found in egg whites, including:

1. Ovalbumin (54%): This is the major protein found in egg whites and is responsible for their white color. It has various functions such as providing nutrition, maintaining the structural integrity of the egg, and protecting the egg from bacteria.
2. Conalbumin (13%): Also known as ovotransferrin, this protein plays a role in the defense against microorganisms by binding to iron and making it unavailable for bacterial growth.
3. Ovomucoid (11%): This protein is resistant to digestion and helps protect the egg from being broken down by enzymes in the digestive tract of predators.
4. Lysozyme (3.5%): This protein has antibacterial properties and helps protect the egg from bacterial infection.
5. Globulins (4%): These are a group of simple proteins found in egg whites that have various functions such as providing nutrition, maintaining the structural integrity of the egg, and protecting the egg from bacteria.
6. Avidin (0.05%): This protein binds to biotin, a vitamin, making it unavailable for use by the body. However, cooking denatures avidin and makes the biotin available again.

Egg proteins are highly nutritious and contain all nine essential amino acids, making them a complete source of protein. They are also low in fat and cholesterol, making them a popular choice for those following a healthy diet.

A larva is a distinct stage in the life cycle of various insects, mites, and other arthropods during which they undergo significant metamorphosis before becoming adults. In a medical context, larvae are known for their role in certain parasitic infections. Specifically, some helminth (parasitic worm) species use larval forms to infect human hosts. These invasions may lead to conditions such as cutaneous larva migrans, visceral larva migrans, or gnathostomiasis, depending on the specific parasite involved and the location of the infection within the body.

The larval stage is characterized by its markedly different morphology and behavior compared to the adult form. Larvae often have a distinct appearance, featuring unsegmented bodies, simple sense organs, and undeveloped digestive systems. They are typically adapted for a specific mode of life, such as free-living or parasitic existence, and rely on external sources of nutrition for their development.

In the context of helminth infections, larvae may be transmitted to humans through various routes, including ingestion of contaminated food or water, direct skin contact with infective stages, or transmission via an intermediate host (such as a vector). Once inside the human body, these parasitic larvae can cause tissue damage and provoke immune responses, leading to the clinical manifestations of disease.

It is essential to distinguish between the medical definition of 'larva' and its broader usage in biology and zoology. In those fields, 'larva' refers to any juvenile form that undergoes metamorphosis before reaching adulthood, regardless of whether it is parasitic or not.

The acrosome is a specialized structure located on the anterior part of the sperm head in many species of animals, including humans. It contains enzymes that help the sperm penetrate the outer covering of the egg (zona pellucida) during fertilization. The acrosome reaction is the process by which the acrosome releases its enzymes, allowing the sperm to digest a path through the zona pellucida and reach the egg plasma membrane for fusion and fertilization.

The acrosome is formed during spermatogenesis, the process of sperm production in the testis, from the Golgi apparatus, a cellular organelle involved in protein trafficking and modification. The acrosome contains hydrolytic enzymes such as hyaluronidase, acrosin, and proteases that are activated during the acrosome reaction to facilitate sperm-egg fusion.

Abnormalities in acrosome formation or function can lead to infertility in males.

Regulator genes are a type of gene that regulates the activity of other genes in an organism. They do not code for a specific protein product but instead control the expression of other genes by producing regulatory proteins such as transcription factors, repressors, or enhancers. These regulatory proteins bind to specific DNA sequences near the target genes and either promote or inhibit their transcription into mRNA. This allows regulator genes to play a crucial role in coordinating complex biological processes, including development, differentiation, metabolism, and response to environmental stimuli.

There are several types of regulator genes, including:

1. Constitutive regulators: These genes are always active and produce regulatory proteins that control the expression of other genes in a consistent manner.
2. Inducible regulators: These genes respond to specific signals or environmental stimuli by producing regulatory proteins that modulate the expression of target genes.
3. Negative regulators: These genes produce repressor proteins that bind to DNA and inhibit the transcription of target genes, thereby reducing their expression.
4. Positive regulators: These genes produce activator proteins that bind to DNA and promote the transcription of target genes, thereby increasing their expression.
5. Master regulators: These genes control the expression of multiple downstream target genes involved in specific biological processes or developmental pathways.

Regulator genes are essential for maintaining proper gene expression patterns and ensuring normal cellular function. Mutations in regulator genes can lead to various diseases, including cancer, developmental disorders, and metabolic dysfunctions.

Sequence homology, amino acid, refers to the similarity in the order of amino acids in a protein or a portion of a protein between two or more species. This similarity can be used to infer evolutionary relationships and functional similarities between proteins. The higher the degree of sequence homology, the more likely it is that the proteins are related and have similar functions. Sequence homology can be determined through various methods such as pairwise alignment or multiple sequence alignment, which compare the sequences and calculate a score based on the number and type of matching amino acids.

A zygote is the initial cell formed when a sperm fertilizes an egg, also known as an oocyte. This occurs in the process of human reproduction and marks the beginning of a new genetic identity, containing 46 chromosomes - 23 from the sperm and 23 from the egg. The zygote starts the journey of cell division and growth, eventually developing into a blastocyst, then an embryo, and finally a fetus over the course of pregnancy.

Tubulin is a type of protein that forms microtubules, which are hollow cylindrical structures involved in the cell's cytoskeleton. These structures play important roles in various cellular processes, including maintaining cell shape, cell division, and intracellular transport. There are two main types of tubulin proteins: alpha-tubulin and beta-tubulin. They polymerize to form heterodimers, which then assemble into microtubules. The assembly and disassembly of microtubules are dynamic processes that are regulated by various factors, including GTP hydrolysis, motor proteins, and microtubule-associated proteins (MAPs). Tubulin is an essential component of the eukaryotic cell and has been a target for anti-cancer drugs such as taxanes and vinca alkaloids.

Nucleic acid hybridization is a process in molecular biology where two single-stranded nucleic acids (DNA, RNA) with complementary sequences pair together to form a double-stranded molecule through hydrogen bonding. The strands can be from the same type of nucleic acid or different types (i.e., DNA-RNA or DNA-cDNA). This process is commonly used in various laboratory techniques, such as Southern blotting, Northern blotting, polymerase chain reaction (PCR), and microarray analysis, to detect, isolate, and analyze specific nucleic acid sequences. The hybridization temperature and conditions are critical to ensure the specificity of the interaction between the two strands.

In genetics, sequence alignment is the process of arranging two or more DNA, RNA, or protein sequences to identify regions of similarity or homology between them. This is often done using computational methods to compare the nucleotide or amino acid sequences and identify matching patterns, which can provide insight into evolutionary relationships, functional domains, or potential genetic disorders. The alignment process typically involves adjusting gaps and mismatches in the sequences to maximize the similarity between them, resulting in an aligned sequence that can be visually represented and analyzed.

In situ hybridization (ISH) is a molecular biology technique used to detect and localize specific nucleic acid sequences, such as DNA or RNA, within cells or tissues. This technique involves the use of a labeled probe that is complementary to the target nucleic acid sequence. The probe can be labeled with various types of markers, including radioisotopes, fluorescent dyes, or enzymes.

During the ISH procedure, the labeled probe is hybridized to the target nucleic acid sequence in situ, meaning that the hybridization occurs within the intact cells or tissues. After washing away unbound probe, the location of the labeled probe can be visualized using various methods depending on the type of label used.

In situ hybridization has a wide range of applications in both research and diagnostic settings, including the detection of gene expression patterns, identification of viral infections, and diagnosis of genetic disorders.

Complementary DNA (cDNA) is a type of DNA that is synthesized from a single-stranded RNA molecule through the process of reverse transcription. In this process, the enzyme reverse transcriptase uses an RNA molecule as a template to synthesize a complementary DNA strand. The resulting cDNA is therefore complementary to the original RNA molecule and is a copy of its coding sequence, but it does not contain non-coding regions such as introns that are present in genomic DNA.

Complementary DNA is often used in molecular biology research to study gene expression, protein function, and other genetic phenomena. For example, cDNA can be used to create cDNA libraries, which are collections of cloned cDNA fragments that represent the expressed genes in a particular cell type or tissue. These libraries can then be screened for specific genes or gene products of interest. Additionally, cDNA can be used to produce recombinant proteins in heterologous expression systems, allowing researchers to study the structure and function of proteins that may be difficult to express or purify from their native sources.

Artificial bacterial chromosomes (ABCs) are synthetic replicons that are designed to function like natural bacterial chromosomes. They are created through the use of molecular biology techniques, such as recombination and cloning, to construct large DNA molecules that can stably replicate and segregate within a host bacterium.

ABCs are typically much larger than traditional plasmids, which are smaller circular DNA molecules that can also replicate in bacteria but have a limited capacity for carrying genetic information. ABCs can accommodate large DNA inserts, making them useful tools for cloning and studying large genes, gene clusters, or even entire genomes of other organisms.

There are several types of ABCs, including bacterial artificial chromosomes (BACs), P1-derived artificial chromosomes (PACs), and yeast artificial chromosomes (YACs). BACs are the most commonly used type of ABC and can accommodate inserts up to 300 kilobases (kb) in size. They have been widely used in genome sequencing projects, functional genomics studies, and protein production.

Overall, artificial bacterial chromosomes provide a powerful tool for manipulating and studying large DNA molecules in a controlled and stable manner within bacterial hosts.

Species specificity is a term used in the field of biology, including medicine, to refer to the characteristic of a biological entity (such as a virus, bacterium, or other microorganism) that allows it to interact exclusively or preferentially with a particular species. This means that the biological entity has a strong affinity for, or is only able to infect, a specific host species.

For example, HIV is specifically adapted to infect human cells and does not typically infect other animal species. Similarly, some bacterial toxins are species-specific and can only affect certain types of animals or humans. This concept is important in understanding the transmission dynamics and host range of various pathogens, as well as in developing targeted therapies and vaccines.

Histones are highly alkaline proteins found in the chromatin of eukaryotic cells. They are rich in basic amino acid residues, such as arginine and lysine, which give them their positive charge. Histones play a crucial role in packaging DNA into a more compact structure within the nucleus by forming a complex with it called a nucleosome. Each nucleosome contains about 146 base pairs of DNA wrapped around an octamer of eight histone proteins (two each of H2A, H2B, H3, and H4). The N-terminal tails of these histones are subject to various post-translational modifications, such as methylation, acetylation, and phosphorylation, which can influence chromatin structure and gene expression. Histone variants also exist, which can contribute to the regulation of specific genes and other nuclear processes.

Molecular evolution is the process of change in the DNA sequence or protein structure over time, driven by mechanisms such as mutation, genetic drift, gene flow, and natural selection. It refers to the evolutionary study of changes in DNA, RNA, and proteins, and how these changes accumulate and lead to new species and diversity of life. Molecular evolution can be used to understand the history and relationships among different organisms, as well as the functional consequences of genetic changes.

Endoderm is the innermost of the three primary germ layers in a developing embryo, along with the ectoderm and mesoderm. The endoderm gives rise to several internal tissues and organs, most notably those found in the digestive system and respiratory system. Specifically, it forms the lining of the gut tube, which eventually becomes the epithelial lining of the gastrointestinal tract, liver, pancreas, lungs, and other associated structures.

During embryonic development, the endoderm arises from the inner cell mass of the blastocyst, following a series of cell divisions and migrations that help to establish the basic body plan of the organism. As the embryo grows and develops, the endoderm continues to differentiate into more specialized tissues and structures, playing a critical role in the formation of many essential bodily functions.

Deoxyribonucleic acid (DNA) is the genetic material present in the cells of organisms where it is responsible for the storage and transmission of hereditary information. DNA is a long molecule that consists of two strands coiled together to form a double helix. Each strand is made up of a series of four nucleotide bases - adenine (A), guanine (G), cytosine (C), and thymine (T) - that are linked together by phosphate and sugar groups. The sequence of these bases along the length of the molecule encodes genetic information, with A always pairing with T and C always pairing with G. This base-pairing allows for the replication and transcription of DNA, which are essential processes in the functioning and reproduction of all living organisms.

Actin is a type of protein that forms part of the contractile apparatus in muscle cells, and is also found in various other cell types. It is a globular protein that polymerizes to form long filaments, which are important for many cellular processes such as cell division, cell motility, and the maintenance of cell shape. In muscle cells, actin filaments interact with another type of protein called myosin to enable muscle contraction. Actins can be further divided into different subtypes, including alpha-actin, beta-actin, and gamma-actin, which have distinct functions and expression patterns in the body.

Messenger RNA (mRNA) is a type of RNA (ribonucleic acid) that carries genetic information copied from DNA in the form of a series of three-base code "words," each of which specifies a particular amino acid. This information is used by the cell's machinery to construct proteins, a process known as translation. After being transcribed from DNA, mRNA travels out of the nucleus to the ribosomes in the cytoplasm where protein synthesis occurs. Once the protein has been synthesized, the mRNA may be degraded and recycled. Post-transcriptional modifications can also occur to mRNA, such as alternative splicing and addition of a 5' cap and a poly(A) tail, which can affect its stability, localization, and translation efficiency.

A multigene family is a group of genetically related genes that share a common ancestry and have similar sequences or structures. These genes are arranged in clusters on a chromosome and often encode proteins with similar functions. They can arise through various mechanisms, including gene duplication, recombination, and transposition. Multigene families play crucial roles in many biological processes, such as development, immunity, and metabolism. Examples of multigene families include the globin genes involved in oxygen transport, the immune system's major histocompatibility complex (MHC) genes, and the cytochrome P450 genes associated with drug metabolism.

Regulatory sequences in nucleic acid refer to specific DNA or RNA segments that control the spatial and temporal expression of genes without encoding proteins. They are crucial for the proper functioning of cells as they regulate various cellular processes such as transcription, translation, mRNA stability, and localization. Regulatory sequences can be found in both coding and non-coding regions of DNA or RNA.

Some common types of regulatory sequences in nucleic acid include:

1. Promoters: DNA sequences typically located upstream of the gene that provide a binding site for RNA polymerase and transcription factors to initiate transcription.
2. Enhancers: DNA sequences, often located at a distance from the gene, that enhance transcription by binding to specific transcription factors and increasing the recruitment of RNA polymerase.
3. Silencers: DNA sequences that repress transcription by binding to specific proteins that inhibit the recruitment of RNA polymerase or promote chromatin compaction.
4. Intron splice sites: Specific nucleotide sequences within introns (non-coding regions) that mark the boundaries between exons (coding regions) and are essential for correct splicing of pre-mRNA.
5. 5' untranslated regions (UTRs): Regions located at the 5' end of an mRNA molecule that contain regulatory elements affecting translation efficiency, stability, and localization.
6. 3' untranslated regions (UTRs): Regions located at the 3' end of an mRNA molecule that contain regulatory elements influencing translation termination, stability, and localization.
7. miRNA target sites: Specific sequences in mRNAs that bind to microRNAs (miRNAs) leading to translational repression or degradation of the target mRNA.

Seawater is not a medical term, but it is a type of water that covers more than 70% of the Earth's surface. Medically, seawater can be relevant in certain contexts, such as in discussions of marine biology, environmental health, or water safety. Seawater has a high salt content, with an average salinity of around 3.5%, which is much higher than that of freshwater. This makes it unsuitable for drinking or irrigation without desalination.

Exposure to seawater can also have medical implications, such as in cases of immersion injuries, marine envenomations, or waterborne illnesses. However, there is no single medical definition of seawater.

A blastocyst is a stage in the early development of a fertilized egg, or embryo, in mammals. It occurs about 5-6 days after fertilization and consists of an outer layer of cells called trophoblasts, which will eventually form the placenta, and an inner cell mass, which will give rise to the fetus. The blastocyst is characterized by a fluid-filled cavity called the blastocoel. This stage is critical for the implantation of the embryo into the uterine lining.

Molecular weight, also known as molecular mass, is the mass of a molecule. It is expressed in units of atomic mass units (amu) or daltons (Da). Molecular weight is calculated by adding up the atomic weights of each atom in a molecule. It is a useful property in chemistry and biology, as it can be used to determine the concentration of a substance in a solution, or to calculate the amount of a substance that will react with another in a chemical reaction.

Genetic transcription is the process by which the information in a strand of DNA is used to create a complementary RNA molecule. This process is the first step in gene expression, where the genetic code in DNA is converted into a form that can be used to produce proteins or functional RNAs.

During transcription, an enzyme called RNA polymerase binds to the DNA template strand and reads the sequence of nucleotide bases. As it moves along the template, it adds complementary RNA nucleotides to the growing RNA chain, creating a single-stranded RNA molecule that is complementary to the DNA template strand. Once transcription is complete, the RNA molecule may undergo further processing before it can be translated into protein or perform its functional role in the cell.

Transcription can be either "constitutive" or "regulated." Constitutive transcription occurs at a relatively constant rate and produces essential proteins that are required for basic cellular functions. Regulated transcription, on the other hand, is subject to control by various intracellular and extracellular signals, allowing cells to respond to changing environmental conditions or developmental cues.

In medical and embryological terms, the mesoderm is one of the three primary germ layers in the very early stages of embryonic development. It forms between the ectoderm and endoderm during gastrulation, and it gives rise to a wide variety of cell types, tissues, and organs in the developing embryo.

The mesoderm contributes to the formation of structures such as:

1. The connective tissues (including tendons, ligaments, and most of the bones)
2. Muscular system (skeletal, smooth, and cardiac muscles)
3. Circulatory system (heart, blood vessels, and blood cells)
4. Excretory system (kidneys and associated structures)
5. Reproductive system (gonads, including ovaries and testes)
6. Dermis of the skin
7. Parts of the eye and inner ear
8. Several organs in the urogenital system

Dysfunctions or abnormalities in mesoderm development can lead to various congenital disorders and birth defects, highlighting its importance during embryogenesis.

Sequence homology in nucleic acids refers to the similarity or identity between the nucleotide sequences of two or more DNA or RNA molecules. It is often used as a measure of biological relationship between genes, organisms, or populations. High sequence homology suggests a recent common ancestry or functional constraint, while low sequence homology may indicate a more distant relationship or different functions.

Nucleic acid sequence homology can be determined by various methods such as pairwise alignment, multiple sequence alignment, and statistical analysis. The degree of homology is typically expressed as a percentage of identical or similar nucleotides in a given window of comparison.

It's important to note that the interpretation of sequence homology depends on the biological context and the evolutionary distance between the sequences compared. Therefore, functional and experimental validation is often necessary to confirm the significance of sequence homology.

Transcription factors are proteins that play a crucial role in regulating gene expression by controlling the transcription of DNA to messenger RNA (mRNA). They function by binding to specific DNA sequences, known as response elements, located in the promoter region or enhancer regions of target genes. This binding can either activate or repress the initiation of transcription, depending on the properties and interactions of the particular transcription factor. Transcription factors often act as part of a complex network of regulatory proteins that determine the precise spatiotemporal patterns of gene expression during development, differentiation, and homeostasis in an organism.

DNA Sequence Analysis is the systematic determination of the order of nucleotides in a DNA molecule. It is a critical component of modern molecular biology, genetics, and genetic engineering. The process involves determining the exact order of the four nucleotide bases - adenine (A), guanine (G), cytosine (C), and thymine (T) - in a DNA molecule or fragment. This information is used in various applications such as identifying gene mutations, studying evolutionary relationships, developing molecular markers for breeding, and diagnosing genetic diseases.

The process of DNA Sequence Analysis typically involves several steps, including DNA extraction, PCR amplification (if necessary), purification, sequencing reaction, and electrophoresis. The resulting data is then analyzed using specialized software to determine the exact sequence of nucleotides.

In recent years, high-throughput DNA sequencing technologies have revolutionized the field of genomics, enabling the rapid and cost-effective sequencing of entire genomes. This has led to an explosion of genomic data and new insights into the genetic basis of many diseases and traits.

I'm sorry for any confusion, but "Kelp" is not a medical term. It is a type of large brown seaweed that grows in underwater forests called kelp beds or kelp forests. Kelps are important in the aquatic ecosystem as they provide food and shelter for many marine organisms. They are also used in various industries such as food, agriculture, and pharmaceuticals. If you have any medical term or concept you would like me to define or explain, I'd be happy to help!

Repetitive sequences in nucleic acid refer to repeated stretches of DNA or RNA nucleotide bases that are present in a genome. These sequences can vary in length and can be arranged in different patterns such as direct repeats, inverted repeats, or tandem repeats. In some cases, these repetitive sequences do not code for proteins and are often found in non-coding regions of the genome. They can play a role in genetic instability, regulation of gene expression, and evolutionary processes. However, certain types of repeat expansions have been associated with various neurodegenerative disorders and other human diseases.

Tissue distribution, in the context of pharmacology and toxicology, refers to the way that a drug or xenobiotic (a chemical substance found within an organism that is not naturally produced by or expected to be present within that organism) is distributed throughout the body's tissues after administration. It describes how much of the drug or xenobiotic can be found in various tissues and organs, and is influenced by factors such as blood flow, lipid solubility, protein binding, and the permeability of cell membranes. Understanding tissue distribution is important for predicting the potential effects of a drug or toxin on different parts of the body, and for designing drugs with improved safety and efficacy profiles.

'Gene expression regulation' refers to the processes that control whether, when, and where a particular gene is expressed, meaning the production of a specific protein or functional RNA encoded by that gene. This complex mechanism can be influenced by various factors such as transcription factors, chromatin remodeling, DNA methylation, non-coding RNAs, and post-transcriptional modifications, among others. Proper regulation of gene expression is crucial for normal cellular function, development, and maintaining homeostasis in living organisms. Dysregulation of gene expression can lead to various diseases, including cancer and genetic disorders.

Proteins are complex, large molecules that play critical roles in the body's functions. They are made up of amino acids, which are organic compounds that are the building blocks of proteins. Proteins are required for the structure, function, and regulation of the body's tissues and organs. They are essential for the growth, repair, and maintenance of body tissues, and they play a crucial role in many biological processes, including metabolism, immune response, and cellular signaling. Proteins can be classified into different types based on their structure and function, such as enzymes, hormones, antibodies, and structural proteins. They are found in various foods, especially animal-derived products like meat, dairy, and eggs, as well as plant-based sources like beans, nuts, and grains.

Calcium is an essential mineral that is vital for various physiological processes in the human body. The medical definition of calcium is as follows:

Calcium (Ca2+) is a crucial cation and the most abundant mineral in the human body, with approximately 99% of it found in bones and teeth. It plays a vital role in maintaining structural integrity, nerve impulse transmission, muscle contraction, hormonal secretion, blood coagulation, and enzyme activation.

Calcium homeostasis is tightly regulated through the interplay of several hormones, including parathyroid hormone (PTH), calcitonin, and vitamin D. Dietary calcium intake, absorption, and excretion are also critical factors in maintaining optimal calcium levels in the body.

Hypocalcemia refers to low serum calcium levels, while hypercalcemia indicates high serum calcium levels. Both conditions can have detrimental effects on various organ systems and require medical intervention to correct.

I'm not aware of a medical definition for the term "water movements." It is possible that it could be used in a specific context within a certain medical specialty or procedure. However, I can provide some general information about how the term "water" is used in a medical context.

In medicine, "water" often refers to the fluid component of the body, which includes all the fluids inside and outside of cells. The movement of water within the body is regulated by various physiological processes, such as osmosis and hydrostatic pressure. Disorders that affect the regulation of water balance can lead to dehydration or overhydration, which can have serious consequences for health.

If you could provide more context or clarify what you mean by "water movements," I may be able to give a more specific answer.

... information Echinoderm Genome Information Web System The Strongylocentrotus purpuratus genome at ... Wikimedia Commons has media related to Strongylocentrotus purpuratus. Wikispecies has information related to Strongylocentrotus ... Strongylocentrotus purpuratus v5.0, is now available on Echinobase. S. purpuratus is one of several biomedical research model ... Strongylocentrotus purpuratus, the purple sea urchin, lives along the eastern edge of the Pacific Ocean extending from Ensenada ...
Laura Rogers-Bennett, "The Ecology of Strongylocentrotus franciscanus and Strongylocentrotus purpuratus" in John M. Lawrence, ... The genome of Strongylocentrotus purpuratus was completed in 2006 and established homology between sea urchin and vertebrate ... Worley, Alisa (2001). "Strongylocentrotus purpuratus". Animal Diversity Web. Retrieved 2016-12-05. "Red Sea Urchin". Thomas A. ... 2006-11-10). "The Genome of the Sea Urchin Strongylocentrotus purpuratus". Science. 314 (5801): 941-952. Bibcode:2006Sci...314 ...
"Strongylocentrotus purpuratus (ID 86) - Genome - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-11-30. "Index of /genomes/refseq/ ... "Index of /genomes/refseq/invertebrate/Strongylocentrotus_purpuratus/latest_assembly_versions/GCF_000002235.5_Spur_5.0". ftp. ...
The sea urchin (Strongylocentrotus purpuratus) spicule proteome. [K. Mann, A.J. Poustka, F.H.Wilt, (2010)Proteome Sci. 8:33] ... 183-210] A genome-wide analysis of biomineralization-related proteins in the sea urchin Strongylocentrotus purpuratus.[B. ... Strongylocentrotus purpuratus. [C.E. Killian, L. Croker, F.H. Wilt (2010) Gene Express. Patt. I0, 135-139] The Dynamics of ...
Barrett D, Edwards BF (1976). Hatching enzyme of the sea urchin Strongylocentrotus purpuratus. Methods in Enzymology. Vol. 45. ...
10 November 2006). "The genome of the sea urchin Strongylocentrotus purpuratus". Science. 314 (5801): 941-52. doi:10.1126/ ... Strongylocentrotus purpuratus. Baker, Michael E.; Nelson, David R.; Studer, Romain A. (July 2015). "Origin of the response to ...
"The Genome of the Sea Urchin Strongylocentrotus purpuratus." Science. 10 November 2006. "Insights into social insects from the ...
November 2006). "The genome of the sea urchin Strongylocentrotus purpuratus". Science. 314 (5801): 941-52. Bibcode:2006Sci... ... Strongylocentrotus purpuratus, a sea urchin and model deuterostome (2006) Syngnathus scovelli', Gulf pipefish (2016, 2023) ... April 2018). "Draft genome of the Peruvian scallop Argopecten purpuratus". GigaScience. 7 (4). doi:10.1093/gigascience/giy031. ... Argopecten purpuratus, peruvian scallop (2018) Bathymodiolus platifrons, seep mussel (2017 Biomphalaria glabrata, a medically ...
In 2006, Maglott was a part of the team analyzing the genome of the sea urchin, Strongylocentrotus purpuratus, which was the ... "The Genome of the Sea Urchin Strongylocentrotus purpuratus". Science. 314 (5801): 941-952. Bibcode:2006Sci...314..941S. doi: ... "A genome-wide analysis of biomineralization-related proteins in the sea urchin Strongylocentrotus purpuratus". Developmental ...
Sea urchin genome sequencing consortium (2006). "The genome of the sea urchin Strongylocentrotus purpuratus". Science. 314 ( ... Strongylocentrotus purpuratus. He devoted a large part of his professional career to developing an understanding of ... especially of the purple sea urchin Strongylocentrotus purpuratus, and in investigating the function of genomic repetitive DNA ...
2006). "The genome of the sea urchin Strongylocentrotus purpuratus". Science. 314 (5801): 941-952. Bibcode:2006Sci...314..941S ...
2006). "The Genome of the Sea Urchin Strongylocentrotus purpuratus". Science. 314 (5801): 941-52. Bibcode:2006Sci...314..941S. ...
Fibropellins I and III from Strongylocentrotus purpuratus (Purple sea urchin). Mammalian hyaluronate-binding protein TSG-6 (or ...
"Entrez Gene: FSCN1 fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)". Shonukan O, Bagayogo I, McCrea P ...
Strongylocentrotus purpuratus and Arbacia punctulata are used for this purpose in embryological studies. The large size and the ... Strongylocentrotus purpuratus Crinoid on a coral reef The oldest candidate echinoderm fossil is Arkarua from the Precambrian of ... "Sperm differentiation in the sea urchins Arbacia punctulata and Strongylocentrotus purpuratus". Journal of Ultrastructure ...
"Entrez Gene: FSCN2 fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)". Hillier LD, Lennon G, ...
December 2006). "The chemical defensome: environmental sensing and response genes in the Strongylocentrotus purpuratus genome ...
In the sea urchin species, Strongylocentrotus purpuratus, speract, a short peptide, was studied. Speract activates a receptor- ...
December 2006). "A genome-wide analysis of biomineralization-related proteins in the sea urchin Strongylocentrotus purpuratus ...
The Genome of the Purple Sea Urchin Strongylocentrotus purpuratus. Science 314: 941-952. Lund, S.G and G.E. Hofmann (2006) ...
On the Oregon coast this species can be found living under purple urchins (Strongylocentrotus purpuratus). This species is ...
R. (2013). Effects of increased pCO2 and geographic origin on purple sea urchin (Strongylocentrotus purpuratus) calcite ...
One of their main prey, the pacific purple sea urchin (Strongylocentrotus purpuratus) eventually began to overpopulate. The ...
Moderate conservation is maintained among other distant species such as: Gallus gallus, Xenopus, Strongylocentrotus purpuratus ...
Strongylocentrotus purpuratus, and Lytechinus pictus). After her PhD, Johnson was a postdoctoral researcher with Piet Borst at ... Her thesis investigated the evolution of exons and introns in actin genes of sea urchins (Strongylocentrotus franciscanus, ... Johnson, Patricia Jean (1984). A molecular comparison of actin genes in sea urchins (Strongylocentrotus franciscanus, S. ... purpuratus, and Lytechinus pictus) (PhD thesis). University of Michigan. OCLC 68294642. "2014 SCEP Symposium". Southern ...
Strongylocentrotus purpuratus". G3. 3 (7): 1069-1083. doi:10.1534/g3.113.005769. PMC 3704236. PMID 23637123. McInerney, James O ... Strongylocentrotus purpuratus (sea urchin), and Arabidopsis thaliana (thale cress). Several viral families (herpesvirus, ...
Strongylocentrotus purpuratus". Biological Bulletin. 163 (2): 285-293. doi:10.2307/1541271. JSTOR 1541271. McClay, David R.; ...
The sea urchins Strongylocentrotus purpuratus and Strongylocentrotus droebachiensis graze on P. californica at the northern end ...
Competition for space with other species (such as the sea urchins Strongylocentrotus purpuratus and Strongylocentrotus ...
Serine/threonine-protein kinase N2 is an enzyme that in humans and Strongylocentrotus purpuratus is encoded by the PKN2 gene. ...
Strongylocentrotus purpuratus information Echinoderm Genome Information Web System The Strongylocentrotus purpuratus genome at ... Wikimedia Commons has media related to Strongylocentrotus purpuratus. Wikispecies has information related to Strongylocentrotus ... Strongylocentrotus purpuratus v5.0, is now available on Echinobase. S. purpuratus is one of several biomedical research model ... Strongylocentrotus purpuratus, the purple sea urchin, lives along the eastern edge of the Pacific Ocean extending from Ensenada ...
Strongylocentrotus purpuratus Cell Line. Embryo Cellular Component. microtubule ensconsin astral microtubule spindle ... George von Dassow, Koen J.C. Verbrugghe, Ann L. Miller, Jenny R. Sider, William M. Bement (2011) CIL:15788, Strongylocentrotus ...
myosin VI [Strongylocentrotus purpuratus] myosin VI [Strongylocentrotus purpuratus]. gi,47550961,ref,NP_999654.1, ... Gene structure in the sea urchin Strongylocentrotus purpuratus based on transcriptome analysis. [Genome Res. 2012] Gene ... structure in the sea urchin Strongylocentrotus purpuratus based on transcriptome analysis.. Tu Q, Cameron RA, Worley KC, Gibbs ...
Strongylocentrotus purpuratus. CC1 : CC1 : Myotubularin : MTMR5 domain. 2. MTMR5-2. Strongylocentrotus purpuratus. CC1 : CC1 : ...
Scientific name: Strongylocentrotus purpuratus. Taxonomy: Kingdom Animalia → Phylum Echinodermata → Subphylum Echinozoa → Class ... Genus Strongylocentrotus. Common name: Purple Sea Urchin. Locations: Eastern Pacific. Group: Marine Life → Invertebrates → Sea ...
Strongylocentrotus purpuratus Creator:. Ridge, Michael C.. Abstract:. Keywords: Zoology 451-452; Strongylocentrotus purpuratus ... Keywords: Echinodermata; Strongylocentrotus purpuratus; Strongylocentrotus franciscanus; Eupentacata quinquesimita; Cucumaria ... Strongylocentrotus purpuratus populations at Boiler Bay Creator:. St. John, Dennis. Abstract:. Keywords: Boiler Bay; ... Stronglyocentrotus purpuratus; Balanus glandula; Anthopleora elegantissima; Pollicipes polymerus; Strongylocentrotus purpuratus ...
... from the egg of the Pacific purple sea urchin Strongylocentrotus purpuratus. We also demonstrate the presence of this PLC ... Cloning of a novel phospholipase C-delta isoform from pacific purple sea urchin (Strongylocentrotus purpuratus) gametes and its ... Cloning of a novel phospholipase C-delta isoform from pacific purple sea urchin (Strongylocentrotus purpuratus) gametes and its ... from the egg of the Pacific purple sea urchin Strongylocentrotus purpuratus. We also demonstrate the presence of this PLC ...
Strongylocentrotus purpuratus. Together they form a unique fingerprint. * Life Biochemistry, Genetics and Molecular Biology ... Strongylocentrotus purpuratus. / Blewett, Tamzin A.; Leonard, Erin M.; Glover, Chris N. et al. In: Comparative Biochemistry and ... Strongylocentrotus purpuratus",. abstract = "Dissolved organic carbon (DOC) is known to ameliorate the toxicity of the trace ... Strongylocentrotus purpuratus. Comparative Biochemistry and Physiology - C Toxicology and Pharmacology, 250, Article 109150. ...
Strongylocentrotus purpuratus. 373200. 9913. Bos taurus. 533829. 9646. Ailuropoda melanoleuca. ENSAMEG00000007732. 9315. ...
Strongylocentrotus purpuratus) SF: 37.5% , DEN: 2. Expert. Novice. Total. SF. 58.33%. 16.67%. 37.5%. ...
Strongylocentrotus purpuratus. 592483. 9358. Choloepus hoffmanni. ENSCHOG00000012053. 10141. Cavia porcellus. ...
Strongylocentrotus purpuratus) SF: 75% , DEN: 2.67. Expert. Novice. Total. SF. 0%. 75%. 75%. ...
Consortium, S. U. G. S. (2006). "The genome of the sea urchin Strongylocentrotus purpuratus." Science, 314, 941-952. ...
Purple sea urchins (Strongylocentrotus purpuratus) and red sea urchins (Mesocentrotus franciscanus). in Van Damme State Park, ... Red sea urchins (Strongylocentrotus franciscanus) are small, round invertebrates covered in spines. They live in shallow ...
Strongylocentrotus purpuratus. Sea urchins have tube feet, which they use for attachment, locomotion and feeding. ...
Strongylocentrotus purpuratus. Sea urchins have tube feet, which they use for attachment, locomotion and feeding. ...
Strongylocentrotus purpuratus Organism: Strongylocentrotus purpuratus Taxonomy: Eukaryota; Metazoa; Echinodermata; Eleutherozoa ...
Strongylocentrotus purpuratus Biological Process. mitotic anaphase Cellular Component. microtubule Eight-cell purple urchin ... Strongylocentrotus purpuratus Biological Process. mitotic anaphase Cellular Component. microtubule 16-cell purple urchin embryo ... Strongylocentrotus purpuratus Biological Process. mitotic anaphase Cellular Component. microtubule Eight-cell purple urchin ... Strongylocentrotus purpuratus Biological Process. mitotic anaphase Cellular Component. microtubule Microtubules in live urchin ...
Strongylocentrotus purpuratus. Sea Cucumber. Unidentified. Club-tipped Anemones. Corynactis californica. Olympus C-5050z. PT- ...
Strongylocentrotus purpuratus Biological Process. mitotic anaphase Cellular Component. microtubule 16-cell purple urchin embryo ... Strongylocentrotus purpuratus Biological Process. mitotic metaphase Cellular Component. microtubule 16-cell purple urchin ... Strongylocentrotus purpuratus Biological Process. cytokinesis after mitosis Cellular Component. microtubule Untreated 16-cell ...
The purple sea urchin, Strongylocentrotus purpuratus, is reported to live for more than 50 years21,22 and, like long-lived ... Loram, J. & Bodnar, A. Age-related changes in gene expression in tissues of the sea urchin Strongylocentrotus purpuratus. ... Ebert, T. A. Demographic patterns of the purple sea urchin Strongylocentrotus purpuratus along a latitudinal gradient, 1985- ... purpuratus23. Microarray analysis revealed 177 age-related differentially expressed genes in S. purpuratus RN23 and comparison ...
Strongylocentrotus purpuratus (Purple sea urchin). 2PTM. CATH. 1.A.1.5.20. Cyclic nucleotide-gated cation channel. ...
Effects of foxa MASO on development. (A-L) Strongylocentrotus purpuratus embryos; (M-P) Lytechinus variegatus embryos. (A-C,J-L ... Effects of foxa MASO on development. (A-L) Strongylocentrotus purpuratus embryos; (M-P) Lytechinus variegatus embryos. (A-C,J-L ... Two Otx proteins generated from multiple transcripts of a single gene in Strongylocentrotus purpuratus. Dev. Biol. ... Expression of Spgatae, the Strongylocentrotus purpuratus ortholog of vertebrate GATA4/5/6 factors. Gene Expr. Patterns ...
The Genome of the Sea Urchin Strongylocentrotus purpuratus. E Sodergren, GM Weinstock, EH Davidson, RA Cameron, RA Gibbs, ... ...
Strongylocentrotus purpuratus spu-miR-5993 mature miRNA Sequence. 1 - UAAAAAUGUGUAGAACAGGUAUC - 23. Evidence. experimental ...
Harris, T. R., Aronov, P. A., and Hammock, B. D. (2008). Soluble epoxide hydrolase homologs in Strongylocentrotus purpuratus ...
Ingelesez) «Sperm differentiation in the sea urchins Arbacia punctulata and Strongylocentrotus purpuratus» Journal of ... Strongylocentrotus purpuratus, kanpoko babes ona duen itsas trikua, armaduratzat har daitekeena. Ekinodermatuek urezko hodi ... Strongylocentrotus purpuratus eta Arbacia punctulata embriologiari buruzko ikerketetan erabiltzen dira.[99] Arrautzen tamaina ...
Now, the genome of the sea urchin Strongylocentrotus purpuratus is the first echinoderm genome to be sequenced. A high quality ...
comm.) and fronds of Corallina officinalis were grazed by Strongylocentrotus purpuratus in field experiments (Littler & Kauker ...

No FAQ available that match "strongylocentrotus purpuratus"

No images available that match "strongylocentrotus purpuratus"