Point Mutation: A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.Mutation, Missense: A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Frameshift Mutation: A type of mutation in which a number of NUCLEOTIDES deleted from or inserted into a protein coding sequence is not divisible by three, thereby causing an alteration in the READING FRAMES of the entire coding sequence downstream of the mutation. These mutations may be induced by certain types of MUTAGENS or may occur spontaneously.Germ-Line Mutation: Any detectable and heritable alteration in the lineage of germ cells. Mutations in these cells (i.e., "generative" cells ancestral to the gametes) are transmitted to progeny while those in somatic cells are not.Pedigree: The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.Mutation Rate: The number of mutations that occur in a specific sequence, GENE, or GENOME over a specified period of time such as years, CELL DIVISIONS, or generations.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Heterozygote: An individual having different alleles at one or more loci regarding a specific character.Amino Acid Substitution: The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Polymorphism, Single-Stranded Conformational: Variation in a population's DNA sequence that is detected by determining alterations in the conformation of denatured DNA fragments. Denatured DNA fragments are allowed to renature under conditions that prevent the formation of double-stranded DNA and allow secondary structure to form in single stranded fragments. These fragments are then run through polyacrylamide gels to detect variations in the secondary structure that is manifested as an alteration in migration through the gels.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Codon, Nonsense: An amino acid-specifying codon that has been converted to a stop codon (CODON, TERMINATOR) by mutation. Its occurance is abnormal causing premature termination of protein translation and results in production of truncated and non-functional proteins. A nonsense mutation is one that converts an amino acid-specific codon to a stop codon.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Homozygote: An individual in which both alleles at a given locus are identical.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Genes, Recessive: Genes that influence the PHENOTYPE only in the homozygous state.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Genes, Dominant: Genes that influence the PHENOTYPE both in the homozygous and the heterozygous state.Genetic Testing: Detection of a MUTATION; GENOTYPE; KARYOTYPE; or specific ALLELES associated with genetic traits, heritable diseases, or predisposition to a disease, or that may lead to the disease in descendants. It includes prenatal genetic testing.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Suppression, Genetic: Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Codon: A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).Cell Line: Established cell cultures that have the potential to propagate indefinitely.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Founder Effect: A phenomenon that is observed when a small subgroup of a larger POPULATION establishes itself as a separate and isolated entity. The subgroup's GENE POOL carries only a fraction of the genetic diversity of the parental population resulting in an increased frequency of certain diseases in the subgroup, especially those diseases known to be autosomal recessive.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Genes, p53: Tumor suppressor genes located on the short arm of human chromosome 17 and coding for the phosphoprotein p53.Syndrome: A characteristic symptom complex.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Mutant Proteins: Proteins produced from GENES that have acquired MUTATIONS.Genetic Linkage: The co-inheritance of two or more non-allelic GENES due to their being located more or less closely on the same CHROMOSOME.Genetic Predisposition to Disease: A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Consanguinity: The magnitude of INBREEDING in humans.Bacterial Proteins: Proteins found in any species of bacterium.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Genes, Lethal: Genes whose loss of function or gain of function MUTATION leads to the death of the carrier prior to maturity. They may be essential genes (GENES, ESSENTIAL) required for viability, or genes which cause a block of function of an essential gene at a time when the essential gene function is required for viability.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Heterozygote Detection: Identification of genetic carriers for a given trait.Exome: That part of the genome that corresponds to the complete complement of EXONS of an organism or cell.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.DNA, Mitochondrial: Double-stranded DNA of MITOCHONDRIA. In eukaryotes, the mitochondrial GENOME is circular and codes for ribosomal RNAs, transfer RNAs, and about 10 proteins.Proto-Oncogene Proteins B-raf: A raf kinase subclass found at high levels in neuronal tissue. The B-raf Kinases are MAP kinase kinase kinases that have specificity for MAP KINASE KINASE 1 and MAP KINASE KINASE 2.Genes, BRCA1: A tumor suppressor gene (GENES, TUMOR SUPPRESSOR) located on human CHROMOSOME 17 at locus 17q21. Mutations of this gene are associated with the formation of HEREDITARY BREAST AND OVARIAN CANCER SYNDROME. It encodes a large nuclear protein that is a component of DNA repair pathways.Mutagenesis, Insertional: Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.Family Health: The health status of the family as a unit including the impact of the health of one member of the family on the family as a unit and on individual family members; also, the impact of family organization or disorganization on the health status of its members.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Gene Frequency: The proportion of one particular in the total of all ALLELES for one genetic locus in a breeding POPULATION.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.DNA, Neoplasm: DNA present in neoplastic tissue.Genetic Variation: Genotypic differences observed among individuals in a population.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.Genes, Bacterial: The functional hereditary units of BACTERIA.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Recombination, Genetic: Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.Microsatellite Repeats: A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.Drug Resistance, Viral: The ability of viruses to resist or to become tolerant to chemotherapeutic agents or antiviral agents. This resistance is acquired through gene mutation.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Jews: An ethnic group with historical ties to the land of ISRAEL and the religion of JUDAISM.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Age of Onset: The age, developmental stage, or period of life at which a disease or the initial symptoms or manifestations of a disease appear in an individual.Genes, Suppressor: Genes that have a suppressor allele or suppressor mutation (SUPPRESSION, GENETIC) which cancels the effect of a previous mutation, enabling the wild-type phenotype to be maintained or partially restored. For example, amber suppressors cancel the effect of an AMBER NONSENSE MUTATION.Kinetics: The rate dynamics in chemical or physical systems.COS Cells: CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)Eye ProteinsConserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Mutagens: Chemical agents that increase the rate of genetic mutation by interfering with the function of nucleic acids. A clastogen is a specific mutagen that causes breaks in chromosomes.INDEL Mutation: A mutation named with the blend of insertion and deletion. It refers to a length difference between two ALLELES where it is unknowable if the difference was originally caused by a SEQUENCE INSERTION or by a SEQUENCE DELETION. If the number of nucleotides in the insertion/deletion is not divisible by three, and it occurs in a protein coding region, it is also a FRAMESHIFT MUTATION.Crosses, Genetic: Deliberate breeding of two different individuals that results in offspring that carry part of the genetic material of each parent. The parent organisms must be genetically compatible and may be from different varieties or closely related species.Genetic Diseases, X-Linked: Genetic diseases that are linked to gene mutations on the X CHROMOSOME in humans (X CHROMOSOME, HUMAN) or the X CHROMOSOME in other species. Included here are animal models of human X-linked diseases.Polymorphism, Restriction Fragment Length: Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Penetrance: The percent frequency with which a dominant or homozygous recessive gene or gene combination manifests itself in the phenotype of the carriers. (From Glossary of Genetics, 5th ed)Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Retinitis Pigmentosa: Hereditary, progressive degeneration of the neuroepithelium of the retina characterized by night blindness and progressive contraction of the visual field.Genes, BRCA2: A tumor suppressor gene (GENES, TUMOR SUPPRESSOR) located on human chromosome 13 at locus 13q12.3. Mutations in this gene predispose humans to breast and ovarian cancer. It encodes a large, nuclear protein that is an essential component of DNA repair pathways, suppressing the formation of gross chromosomal rearrangements. (from Genes Dev 2000;14(11):1400-6)Ethylnitrosourea: A nitrosourea compound with alkylating, carcinogenic, and mutagenic properties.RNA Splicing: The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.RNA Splice Sites: Nucleotide sequences located at the ends of EXONS and recognized in pre-messenger RNA by SPLICEOSOMES. They are joined during the RNA SPLICING reaction, forming the junctions between exons.Selection, Genetic: Differential and non-random reproduction of different genotypes, operating to alter the gene frequencies within a population.Genes, Fungal: The functional hereditary units of FUNGI.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Mice, Mutant Strains: Mice bearing mutant genes which are phenotypically expressed in the animals.Abnormalities, MultipleRecombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Protein Structure, Secondary: The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.Tumor Suppressor Protein p53: Nuclear phosphoprotein encoded by the p53 gene (GENES, P53) whose normal function is to control CELL PROLIFERATION and APOPTOSIS. A mutant or absent p53 protein has been found in LEUKEMIA; OSTEOSARCOMA; LUNG CANCER; and COLORECTAL CANCER.Polymorphism, Single Nucleotide: A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.BRCA2 Protein: A large, nuclear protein, encoded by the BRCA2 gene (GENE, BRCA2). Mutations in this gene predispose humans to breast and ovarian cancer. The BRCA2 protein is an essential component of DNA repair pathways, suppressing the formation of gross chromosomal rearrangements. (from Genes Dev. 2000;14(11):1400-6)Repressor Proteins: Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.Fungal Proteins: Proteins found in any species of fungus.DNA Repair: The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.ras Proteins: Small, monomeric GTP-binding proteins encoded by ras genes (GENES, RAS). The protooncogene-derived protein, PROTO-ONCOGENE PROTEIN P21(RAS), plays a role in normal cellular growth, differentiation and development. The oncogene-derived protein (ONCOGENE PROTEIN P21(RAS)) can play a role in aberrant cellular regulation during neoplastic cell transformation (CELL TRANSFORMATION, NEOPLASTIC). This enzyme was formerly listed as EC 3.6.1.47.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Drosophila melanogaster: A species of fruit fly much used in genetics because of the large size of its chromosomes.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Drosophila Proteins: Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Eye Abnormalities: Congenital absence of or defects in structures of the eye; may also be hereditary.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Cercopithecus aethiops: A species of CERCOPITHECUS containing three subspecies: C. tantalus, C. pygerythrus, and C. sabeus. They are found in the forests and savannah of Africa. The African green monkey (C. pygerythrus) is the natural host of SIMIAN IMMUNODEFICIENCY VIRUS and is used in AIDS research.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Asian Continental Ancestry Group: Individuals whose ancestral origins are in the southeastern and eastern areas of the Asian continent.Genetic Heterogeneity: The presence of apparently similar characters for which the genetic evidence indicates that different genes or different genetic mechanisms are involved in different pedigrees. In clinical settings genetic heterogeneity refers to the presence of a variety of genetic defects which cause the same disease, often due to mutations at different loci on the same gene, a finding common to many human diseases including ALZHEIMER DISEASE; CYSTIC FIBROSIS; LIPOPROTEIN LIPASE DEFICIENCY, FAMILIAL; and POLYCYSTIC KIDNEY DISEASES. (Rieger, et al., Glossary of Genetics: Classical and Molecular, 5th ed; Segen, Dictionary of Modern Medicine, 1992)DNA Transposable Elements: Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.Mice, Transgenic: Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.Genetic Markers: A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.Drug Resistance, Microbial: The ability of microorganisms, especially bacteria, to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).Amino Acid Motifs: Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.Trans-Activators: Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.Genetic Association Studies: The analysis of a sequence such as a region of a chromosome, a haplotype, a gene, or an allele for its involvement in controlling the phenotype of a specific trait, metabolic pathway, or disease.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Loss of Heterozygosity: The loss of one allele at a specific locus, caused by a deletion mutation; or loss of a chromosome from a chromosome pair, resulting in abnormal HEMIZYGOSITY. It is detected when heterozygous markers for a locus appear monomorphic because one of the ALLELES was deleted.X Chromosome: The female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in human and other male-heterogametic species.Codon, Terminator: Any codon that signals the termination of genetic translation (TRANSLATION, GENETIC). PEPTIDE TERMINATION FACTORS bind to the stop codon and trigger the hydrolysis of the aminoacyl bond connecting the completed polypeptide to the tRNA. Terminator codons do not specify amino acids.Mosaicism: The occurrence in an individual of two or more cell populations of different chromosomal constitutions, derived from a single ZYGOTE, as opposed to CHIMERISM in which the different cell populations are derived from more than one zygote.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Ethyl Methanesulfonate: An antineoplastic agent with alkylating properties. It also acts as a mutagen by damaging DNA and is used experimentally for that effect.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Immunohistochemistry: Histochemical localization of immunoreactive substances using labeled antibodies as reagents.Drosophila: A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.Arginine: An essential amino acid that is physiologically active in the L-form.Chromosome Deletion: Actual loss of portion of a chromosome.Adenosine Triphosphatases: A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.HIV-1: The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Homeodomain Proteins: Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).Osteochondrodysplasias: Abnormal development of cartilage and bone.Protein-Serine-Threonine Kinases: A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.Family: A social group consisting of parents or parent substitutes and children.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.Alanine: A non-essential amino acid that occurs in high levels in its free state in plasma. It is produced from pyruvate by transamination. It is involved in sugar and acid metabolism, increases IMMUNITY, and provides energy for muscle tissue, BRAIN, and the CENTRAL NERVOUS SYSTEM.Drug Resistance: Diminished or failed response of an organism, disease or tissue to the intended effectiveness of a chemical or drug. It should be differentiated from DRUG TOLERANCE which is the progressive diminution of the susceptibility of a human or animal to the effects of a drug, as a result of continued administration.Tumor Suppressor Proteins: Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.Neoplasm Proteins: Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.Mice, Inbred C57BLHeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.HEK293 Cells: A cell line generated from human embryonic kidney cells that were transformed with human adenovirus type 5.Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.Glycine: A non-essential amino acid. It is found primarily in gelatin and silk fibroin and used therapeutically as a nutrient. It is also a fast inhibitory neurotransmitter.Cell Line, Tumor: A cell line derived from cultured tumor cells.Genes, APC: Tumor suppressor genes located in the 5q21 region on the long arm of human chromosome 5. The mutation of these genes is associated with familial adenomatous polyposis (ADENOMATOUS POLYPOSIS COLI) and GARDNER SYNDROME, as well as some sporadic colorectal cancers.BRCA1 Protein: The phosphoprotein encoded by the BRCA1 gene (GENE, BRCA1). In normal cells the BRCA1 protein is localized in the nucleus, whereas in the majority of breast cancer cell lines and in malignant pleural effusions from breast cancer patients, it is localized mainly in the cytoplasm. (Science 1995;270(5237):713,789-91)Deafness: A general term for the complete loss of the ability to hear from both ears.Disease Models, Animal: Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.Nerve Tissue ProteinsNucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.Adaptor Proteins, Signal Transducing: A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymesSerine: A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.HIV Reverse Transcriptase: A reverse transcriptase encoded by the POL GENE of HIV. It is a heterodimer of 66 kDa and 51 kDa subunits that are derived from a common precursor protein. The heterodimer also includes an RNAse H activity (RIBONUCLEASE H, HUMAN IMMUNODEFICIENCY VIRUS) that plays an essential role the viral replication process.Genetic Diseases, Inborn: Diseases that are caused by genetic mutations present during embryo or fetal development, although they may be observed later in life. The mutations may be inherited from a parent's genome or they may be acquired in utero.Membrane Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.Cytoskeletal Proteins: Major constituent of the cytoskeleton found in the cytoplasm of eukaryotic cells. They form a flexible framework for the cell, provide attachment points for organelles and formed bodies, and make communication between parts of the cell possible.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Mitochondrial Diseases: Diseases caused by abnormal function of the MITOCHONDRIA. They may be caused by mutations, acquired or inherited, in mitochondrial DNA or in nuclear genes that code for mitochondrial components. They may also be the result of acquired mitochondria dysfunction due to adverse effects of drugs, infections, or other environmental causes.Operon: In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.Colorectal Neoplasms: Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI.Hearing Loss, Sensorineural: Hearing loss resulting from damage to the COCHLEA and the sensorineural elements which lie internally beyond the oval and round windows. These elements include the AUDITORY NERVE and its connections in the BRAINSTEM.Ultraviolet Rays: That portion of the electromagnetic spectrum immediately below the visible range and extending into the x-ray frequencies. The longer wavelengths (near-UV or biotic or vital rays) are necessary for the endogenous synthesis of vitamin D and are also called antirachitic rays; the shorter, ionizing wavelengths (far-UV or abiotic or extravital rays) are viricidal, bactericidal, mutagenic, and carcinogenic and are used as disinfectants.Cysteine: A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.DNA Gyrase: A bacterial DNA topoisomerase II that catalyzes ATP-dependent breakage of both strands of DNA, passage of the unbroken strands through the breaks, and rejoining of the broken strands. Gyrase binds to DNA as a heterotetramer consisting of two A and two B subunits. In the presence of ATP, gyrase is able to convert the relaxed circular DNA duplex into a superhelix. In the absence of ATP, supercoiled DNA is relaxed by DNA gyrase.Breast Neoplasms: Tumors or cancer of the human BREAST.Genes, Regulator: Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Cell Transformation, Neoplastic: Cell changes manifested by escape from control mechanisms, increased growth potential, alterations in the cell surface, karyotypic abnormalities, morphological and biochemical deviations from the norm, and other attributes conferring the ability to invade, metastasize, and kill.Dimerization: The process by which two molecules of the same chemical composition form a condensation product or polymer.

*  PSEN1 T116 Mutations | ALZFORUM
Mutations Position Table. PSEN1 T116 Mutations. Search Mutations , Mutations Home. Tools ... Mutation Type Codon Change. Research Models. Primary Papers. T116I. Alzheimer's Disease. ... Mutation. Clinical Phenotype. Pathogenicity. Neuropathology. Biological Effect. Genomic ......
http://alzforum.org/mutation-position-table/psen1-t116-mutations
*  M73 - Mutation at Residue 73 | AcronymFinder
M73 stands for Mutation at Residue 73. M73 is defined as Mutation at Residue 73 very ... www.acronymfinder.com/Mutation-at-Residue-73-(M73).html ... 2017 http://www.acronymfinder.com/Mutation-at-Residue-73-(M73).html. *Chicago style: ... a href='http://www.acronymfinder.com/Mutation-at-Residue-73-(M73).html',M73,/a,. ......
http://acronymfinder.com/Mutation-at-Residue-73-
*  Query by HBV gp1 RT Mutation
1998-2015. All Rights Reserved. Questions? Contact HIVDB ......
http://hivdb.stanford.edu/HBV/DB/cgi-bin/GetHBVRTByGenotypeRx.cgi?subtype=E&pos=214&AA=A&rx=RTINaive&includeMixtures=
*  Query by HBV gp1 RT Mutation
... Mutation. 146S. Treatment. L-Nucleoside analogs and/or ETV ......
http://hivdb.stanford.edu/HBV/DB/cgi-bin/GetHBVRTByGenotypeRx.cgi?subtype=All&pos=146&AA=S&rx=LANA&includeMixtures=
*  Query by HBV gp1 RT Mutation
21S, 122L, 130P, 184A, 263E, 274K, ......
http://hivdb.stanford.edu/HBV/DB/cgi-bin/GetHBVRTByGenotypeRx.cgi?subtype=D&pos=184&AA=A&rx=RTINaive&includeMixtures=
*  Query by HBV gp1 RT Mutation
13H, 31E, 32R, 34L, 35Y, 55N, 91L, 101P, 109S, 118N, 121I, 122N, 124N, 126Y, 131N, 151Y, ......
http://hivdb.stanford.edu/HBV/DB/cgi-bin/GetHBVRTByGenotypeRx.cgi?subtype=C&pos=151&AA=Y&rx=RTINaive&includeMixtures=
*  Gene Mutation May Speed Learning ( Finding might yield insights into dis...)
Mutation,May,Speed,Learning,,medicine,medical news today,latest medical news,medical ... Gene Mutation Improves Response to Lung Cancer Drug. 3. Mutation in renin gene linked to ... Study Shows a Link Between Schizophrenia & Genetic Mutations. 8. Gene Mutation Is Linked ... Patients with EGFR Mutations. 6. Gene Mutation Could Be Key to Rare Blood Vessel Disease ......
http://bio-medicine.org/medicine-news-1/Gene-Mutation-May-Speed-Learning--59308-1/
*  Rare SF3B1 R625 mutations in cutaneous melanoma : Melanoma Research
Recurrent mutation in codon 625 has been found in uveal melanoma, but this mutation has ... Rare SF3B1 R625 mutations in cutaneous melanoma. Kong, Yonga,b; Krauthammer, Michaelc; ... Rare SF3B1 R625 mutations in cutaneous melanoma Melanoma Research. 24(4):332-334, August ... Home , August 2014 - Volume 24 - Issue 4 , Rare SF3B1 R625 mutations in cutaneous ......
http://journals.lww.com/melanomaresearch/Abstract/2014/08000/Rare_SF3B1_R625_mutations_in_cutaneous_melanoma.6.aspx
*  Progranulin null mutations in both sporadic and familial frontotemporal...
Progranulin null mutations in both sporadic and familial frontotemporal dementia†‡. * ... Progranulin null mutations in both sporadic and familial frontotemporal dementia. Hum. ......
http://onlinelibrary.wiley.com/doi/10.1002/humu.20520/references
*  British Library EThOS: SQSTM1 mutations and Paget's disease of bone
These include mutations which affect regions of p62 outside of the ubiquitin-binding UBA ... Mutations affecting the p62 signalling adapter protein are commonly found in patients ... In accordance with previous findings, both of the non-UBA domain mutations (A381V, ∆351- ... in PDB with p62 mutations may be directly related to the effects of the mutations on the ......
http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.526654
*  Point mutation
... A 'point mutation', or 'single base modification', is a type of mutation that causes a single nucleotide base change, insertion, or deletion of the genetic material, DNA or RNA. General consequences of point mutations Specific diseases caused by point mutations Cystic fibrosis. Tay–Sachs disease. Causes of point mutations. Point mutations usually take place during DNA replication. A single point mutation can change the whole DNA sequence. Missense mutations : Code for a different amino acid. Most proteins can withstand one or two point mutations before their function changes. For example, sickle-cell disease is caused by a single point mutation a missense mutation in the beta- hemoglobin gene that converts a GAG codon into GUG, which encodes the amino acid valine rather than glutamic acid. A single nucleotide can change, but the new codon specifies the same amino acid, resulting in an unmutated protein. This type of change is called synonymous change, since the old and new codon code for the same amino a...
https://en.wikipedia.org/wiki/Point_mutation
*  Newly Identified Mechanism for Silencing Genes Points to Possible | Wistar
Newly Identified Mechanism for Silencing Genes Points to Possible. Wistar. Postdoctoral Programs Predoctoral Programs High School Programs. Annual Biology Essay Contest Biomedical Research for High School Students Awards for Trainee Excellence Chemistry-Biology Interface Training Program Biomedical Technician Training Program Cancer Biology Graduate Program Support Wistar. Press Releases Gallery Glossary WHYY Annual Report Fact Sheets Focus Newsletter Contact Us Events. Wistar Today. Wistar Today. Wistar Wire. Wistar Today. Press Releases Newly Identified Mechanism for Silencing Genes Points to Possible Wistar Today. Press Releases Glossary Annual Report Gallery Fact Sheets E-Newsletter Focus Newsletter Podcast Contact Us Events Wistar Wire. Newly Identified Mechanism for Silencing Genes Points to Possible Newly Identified Mechanism for Silencing Genes Points to Possible Share. In a new study published online May 16 in the journal Nature, a team of scientists at The Wistar Institute and the University of Cali...
http://wistar.org/news-and-media/press-releases/newly-identified-mechanism-silencing-genes-points-possible
*  What is a Mutation?
What is a Mutation. A mutation occurs whenever there is a change in the genetic information of an organism, due to a variety of causes. There are two classes of mutation: point mutations, and frameshift mutations Some texts and professors classify frameshift as point mutations; others see it as such a different event with drastically different. Point mutations are single base changes, that do not affect the reading frame; that is, the mutation only makes a single change in a single codon, and everything else is undisturbed. There are three types of point mutation:. Silent Mutation : There is a base change, but the new codon means exactly the same thing as the old one; this is due to the degeneracy of the codon - amino acid conversion code. There is no phenotypic change. Missense Mutation : The mutation alters the meaning of the codon, so that the amino acid coded for is not the one that is supposed to be there. This could have no phenotypic effect, if the substituted amino acid was similar in character to the...
http://utminers.utep.edu/rwebb/html/what_is_a_mutation_.html
*  Point Mutation Problem
... Mike Perry mike.perry at bris.ac.uk. Previous message: Point Mutation Problem Next message: Primer extension. Messages sorted by:. Kelly R. Pitts wrote: I am currently working on developing a mutant protein. Using a PCR based technique with my gene of interest in a pUC vector, I successfully changed the codon AAG to GCG K to A mutation by changing the first two nucleotides AA to GC, as evidenced by sequencing. I isolated the mutant insert from pUC and cloned into pcDNA3. Sequence confirmed the presence of the mutation. I then isolated mutant insert from pcDNA3 and cloned into pEGFP-C1. Sequence showed that the mutation reverted back to the wild type nucleotides. Several attempts always showed a reversion of mutation. Thinking that there could be some contamination, after isolating the mutant gene from pcDNA3, I sequenced both the pcDNA3/mutant construct AND the gel isolated mutant insert. BOTH showed the presence of the mutation. I did the ligations mutant insert into pEGFP-C1, isolated clones, and seque...
http://bio.net/bionet/mm/methods/1997-July/059142.html
*  Category:SWL/mutation results in
category swl mutation results in category swl mutation results in category swl this property indicates that abnormalities in a gene point mutations translocations etc may be associated with the manifestation of a disease external formal definitions...
https://en.wikipedia.org/wiki/Category:SWL/mutation_results_in
*  Double point to circular - KnittingHelp.com Forum
... Learn to knit with KnittingHelp.com. Forum. Patterns. Today's Posts. Search. Search Forums. Show Threads Show Posts. Advanced Search. KnittingHelp.com Forum KnittingHelp.com How-to Questions Double point to circular. Previous Thread Next Thread. Thread Tools. Display Modes. 10-10-2012, 08:27 PM. judyh31. Join Date: Oct 2012. Posts: 1. Thanked 0 Times in 0 Posts. Double point to circular. I'm an advanced beginner having knit vests with circulars and socks with double points. Am now beginning a pair of handwarmers with directions for double points. Just use the circulars to knit in the round??. judyh31. View Public Profile. Send a private message to judyh31. Find More Posts by judyh31. 10-10-2012, 08:35 PM. Ingrid. Posts: 29,585. Thanked 2,253 Times in 1,844 Posts. Do you mean switching from dpns to circular at some point. Once you have enough stitches to fit around on your circulars, you just knit from the dpns to the circular. IngridKH on Ravelry. Ingrid. View Public Profile. Send a private message to In...
http://knittinghelp.com/forum/showthread.php?t=110661&goto=nextoldest
*  mutation | genetics | Britannica.com
genetics. Britannica.com. quizzes. Web sites. Genetics. point mutation: isoleucine and point mutations Encyclopædia Britannica, Inc. Mutations in egg or sperm cells. germinal mutations may result in an individual offspring all of whose cells carry the mutation, which often confers some serious malfunction, as in the case of a human genetic disease such as cystic fibrosis. Cells make 20 common amino acids, and it is the unique number and sequence of these that give a protein its specific function. Hence, a mutation that changes DNA sequence can change amino acid sequence and in this way potentially reduce or inactivate a protein’s function. A change in the DNA sequence of a gene’s regulatory region can adversely affect the timing and availability of the gene’s protein and also lead to serious cellular malfunction. silent mutations are in the DNA between genes, or they are of a type that results in no significant amino acid changes. Changes within genes are called. Mutations that span more than one gene are cal...
http://britannica.com/science/mutation-genetics
*  help/help
help help help help wellcome trust research labs nairobi wellcome at users africaonline co ke sun feb est previous message collaboration offered non ltr retrotransposones study next message interspersed sequences messages sorted by to the group i am analysing point mutation dihydroreductase gene of p falciparum this gene encodes for the protein target of pyrimethamine the drug used against this parasites it is known that point mutation are linked the decrease of pyr effectiveness on isolates mainly there are point mutations one prerequisite at codon two others occurring independently or together always with the mutation at codon my question is can we assess the order in with the others mutations appear based on their frequencies if yes which test to use and the related references my regards to all dr alexis nzila wellcome at users africaonline co ke specify message for alexis nzila previous message collaboration offered non ltr retrotransposones study next message interspersed sequences messages sorted by mor...
http://bio.net/bionet/mm/biochrom/1997-February/001433.html
*  BRCA mutation
2 The risk of breast and ovarian cancer is higher for women with a high-risk 'BRCA1' mutation than with a 'BRCA2' mutation. Deleterious mutations have high, but not complete, genetic penetrance, which means that people with the mutation have a high risk of developing disease as a result, but that some people will not develop cancer despite carrying a harmful mutation. A negative test result, if a specific mutation is known to be present in the family, shows that the person does not have a 'BRCA'-related predisposition for cancer, although it does not guarantee that the person will not develop a non-hereditary case of cancer. Breast and ovarian cancer risk. Women with deleterious mutations in either the 'BRCA1' or 'BRCA2' genes have a high risk of developing breast and/or ovarian cancer. Approximately 50% to 65% of women born with a deleterious mutation in 'BRCA1' will develop breast cancer by age 70, and 35% to 46% will develop ovarian cancer by age 70. Approximately 40% to 57% of women with a deleterious mut...
https://en.wikipedia.org/wiki/BRCA_mutation
*  Mutation and disease
... redirect mutation...
https://en.wikipedia.org/wiki/Mutation_and_disease
*  Crystalline Cataract Caused by a Heterozygous Missense Mutation in γD-Crystallin (CRYGD)
Crystalline Cataract Caused by a Heterozygous Missense Mutation in γD-Crystallin CRYGD. Crystalline Cataract Caused by a Heterozygous Missense Mutation in γD-Crystallin CRYGD. DASH Home. Harvard Medical School. HMS Scholarly Articles View Item. Crystalline Cataract Caused by a Heterozygous Missense Mutation in γD-Crystallin CRYGD. Download Full Text. Crystalline Cataract Caused by a Heterozygous Missense Mutation in γD-Crystallin CRYGD. Nihalani, Bharti R. ; Vanderveen, Deborah K. ; Andrews, Caroline ; Engle, Elizabeth Carson Note: Order does not necessarily reflect citation order of authors. VanderVeen, Deborah K., Caroline Andrews, Bharti R. Nihalani, and Elizabeth C. Crystalline cataract caused by a heterozygous missense mutation in γd-crystallin crygd. Full Text Related Files:. 3247172.pdf 1.479Mb; PDF. Purpose: To describe phenotypic characteristics of two pedigrees manifesting early onset crystalline cataract with mutations in the γD-crystallin gene CRYGD. Methods: A detailed medical history was obtaine...
http://dash.harvard.edu/handle/1/8646757
*  RAB7A - Ras-related protein Rab-7a - human protein (Function)
Evidence 1: experimental evidence used in manual assertion UniProtKB. Show abstract. Evidence 2: experimental evidence used in manual assertion UniProtKB. Evidence 6: sequence similarity evidence used in manual assertion UniProtKB. P51150 Evidence 7: experimental evidence used in manual assertion UniProtKB. Functional characterization of Rab7 mutant proteins associated with Charcot-Marie-Tooth type 2B disease. Recently, four missense mutations in the small GTPase Rab7 associated with the Charcot-Marie Tooth type 2B phenotype have been identified. Functional characterization of Rab7 mutant proteins associated with Charcot-Marie-Tooth type 2B disease. Recently, four missense mutations in the small GTPase Rab7 associated with the Charcot-Marie Tooth type 2B phenotype have been identified. Functional characterization of Rab7 mutant proteins associated with Charcot-Marie-Tooth type 2B disease. Recently, four missense mutations in the small GTPase Rab7 associated with the Charcot-Marie Tooth type 2B phenotype have ...
http://nextprot.org/db/entry/NX_P51149
*  missense mutation | genetics | Britannica.com
. missense mutation. genetics. Britannica.com. Shop. School and Library Subscribers. JOIN. LOGIN. Activate Your Free Trial. Stories. quizzes. galleries. lists. Missense mutation. Genetics. Contribute your ideas for this topic. Thank you for helping us expand this topic. Simply begin typing or use the editing tools above to add to this article. Once you are finished and click submit, your modifications will be sent to our editors for review. This topic is discussed in the following articles: genetic mutations heredity genetics : Mechanisms of mutation ...a codon that codes for a different amino acid that happens to have the same properties as those in the wild type. Substitutions that result in a functionally different amino acid are called “missense” mutations; these can lead to alteration or loss of protein function. A more severe type of base substitution, called a “nonsense” mutation, results in a stop codon in a... point mutation ...point mutations often manifest as functional changes in the final protein...
http://britannica.com/science/missense-mutation
*  Missense mutation
thumb|upright=1.3|This image shows an example of missense mutation. One of the nucleotides adenine is replaced by another nucleotide cytosine in the DNA sequence. In genetics, a 'missense mutation' a type of nonsynonymous substitution is a point mutation in which a single nucleotide change results in a codon that codes for a different amino acid. 3 In the most common variant of sickle-cell disease, the 20th nucleotide of the gene for the beta chain of hemoglobin is altered from the codon GAG to GTG. Thus, the 6th amino acid glutamic acid is substituted by valine — notated as an "E6V" mutation — and the protein is sufficiently altered to cause the sickle-cell disease. When an amino acid may be encoded by more than one codon so-called "degenerate coding" a mutation in a codon may not produce any change in translation; this would be a silent mutation a type of synonymous substitution, which is not always silent and not a missense mutation. Example Experimental analysis See also References External links. File:LM...
https://en.wikipedia.org/wiki/Missense_mutation
*  Describe the effects mutations have on protein structure and function? - Homework Help - eNotes.com
Describe the effects mutations have on protein structure and function. - Homework Help - eNotes.com. Homework Help. Essay Lab. Study Tools ▻. Literature Guides. Quizzes. eTexts. Textbook Solutions. Research Paper Topics. Teachers ▻. For Teachers. Literature Lesson Plans. Literature Quizzes. Downloads. Sign In. Join. rows eNotes search. Sign In. Join. . Describe the effects mutations have on protein structure and function. Topic: Science. Asked on September 19, 2013 at 1:16 AM. by mlunar74. like 1. dislike 0. 1 Answer. Add Yours. mvcdc. Student, Graduate. Level 1 Associate Educator. Posted on September 19, 2013 at 2:58 AM Answer #1. Mutations are changes in the DNA sequence of the genome. These are caused by a lot of factors including unrepaired damage the failure of the DNA repair mechanism, errors in replication, or errors during synthesis. Some mutations include substitution, deletion, insertion, inversion, translocation, and chromosomal rearrangements. Proteins are essentially derived from th...
http://enotes.com/homework-help/describe-effects-mutations-have-protein-structure-454615
*  NIF | Searching in Literature
NIF. Searching in Literature. SciCrunch relies heavily on JavaScript. Many functions on the site will not work if you continue with JavaScript disabled. Login. Register. NIF LinkOut Portal. About. Add a Resource. Literature. Go. X. Sign In. Log In. X Forgot Password. If you have forgotten your password you can enter your email here and get a temporary password sent to your email. Send. X. Leaving Community. Are you sure you want to leave this community. Leaving the community will revoke any permissions you have been granted in this community. No. Yes. Literature. Home Literature. Roles for Dnmt3b in mammalian development: a mouse model for the ICF syndrome. ICF Immunodeficiency, Centromeric instability and Facial anomalies syndrome is a rare autosomal recessive disease caused by mutations in the DNA methyltransferase gene DNMT3B. To investigate the function of Dnmt3b in mouse development and to create animal models for ICF syndrome, we have generated three mutant alleles of Dnmt3b in mice: one carrying a dele...
https://scicrunch.org/16501171/resource/nif-0000-34000
*  .. Missense Meanderings
Home » Evolution » Missense Meanderings. Missense Meanderings. September 29, 2005. Posted by William Dembski under Evolution. 118 Comments. MISSENSE MEANDERINGS IN SEQUENCE SPACE: A BIOPHYSICAL VIEW OF PROTEIN EVOLUTION Mark A. DePristo, Daniel M. Weinreich and Daniel L. Hartl. “Taken as a whole, recent findings from biochemistry and evolutionary biology indicate that our understanding of protein evolution is incomplete, if not fundamentally flawed.”. Abstract. Proteins are finicky molecules; they are barely stable and are prone to aggregate, but they must function in a crowded environment that is full of degradative enzymes bent on their destruction. It is no surprise that many common diseases are due to missense mutations that affect protein stability and aggregation. Here we review the literature on biophysics as it relates to molecular evolution, focusing on how protein stability and aggregation affect organismal fitness. We then advance a biophysical model of protein evolution that helps us to understand...
http://uncommondescent.com/evolution/missense-meanderings/
*  Eat Right For Your Type: The Individualist: Mutation
Most common is the transition that exchanges a purine for a purine A ↔ G or a pyrimidine for a pyrimidine, C ↔ T. Less common is a transversion, which exchanges a purine for a pyrimidine or a pyrimidine for a purine C/T ↔ A/G. Deletions of large chromosomal regions, leading to loss of the genes within those regions. By effect on function Loss-of-function mutations are the result of gene product having less or no function. Dominant negative mutations also called antimorphic mutations have an altered gene product that acts antagonistically to the wild type allele. These mutations usually result in an altered molecular function often inactive and are characterised by a dominant or semi-dominant phenotype. By effect on gene expression Hypomorphic mutations are mutations that cause reduced function of the gene product, or a negative change in expression of the gene. Neomorphic mutations cause a novel molecular function or expression of the gene product. Causes of mutation Two classes of mutations are spontaneous m...
http://drpeterjdadamo.com/wiki/wiki.pl/Rhesus_(Rh)_Blood_Group/Mutation
*  Silent mutation
When they occur within exons they either do not result in a change to the amino acid sequence of a protein a " synonymous substitution ", or result in the insertion of an alternative amino acid with similar properties to that of the original amino acid; in either case there is no significant change in phenotype. The phrase 'silent mutation' is often used interchangeably with the phrase ' synonymous mutation '; however, synonymous mutations only occur within exons, and are not always silent mutations. Synonymous mutations can affect transcription, splicing, mRNA transport, and translation, any of which could alter phenotype, rendering the synonymous mutation non-silent. Mutations that cause the altered codon to produce an amino acid with similar functionality 'e.g.' a mutation producing leucine instead of isoleucine are often classified as silent; if the properties of the amino acid are conserved, this mutation does not usually significantly affect protein function. Silent mutations and the genetic code. Silen...
https://en.wikipedia.org/wiki/Silent_mutation
*  Neutral mutation
The neutral theory of molecular evolution is an important and often controversial theory proposing that most molecular variation within and among species is essentially neutral and not acted on by selection. History Impact on evolutionary theory Types of neutral mutation Synonymous mutation of bases. Neutral amino acid substitution. This theory has become known as the neutral theory of molecular evolution. Neutral mutation and the neutral theory of molecular evolution are not separate from natural selection but add to Darwin's original thoughts. 3 A number of observations associated with neutral mutation were predicted in neutral theory including: amino acids with similar biochemical properties should be substituted more often than biochemically different amino acids; synonymous base substitutions should be observed more often than nonsynonymous substitutions; intron s should evolve at the same rate as synonymous mutations in coding exon s; and pseudogenes should also evolve at a similar rate. Synonymous muta...
https://en.wikipedia.org/wiki/Neutral_mutation
*  The list of related mutation databases
... 関連変異データベース En. Acknowledgement: JST acknowledges these databases for assisting our service. database abbreviation institutes managing database comments dbSNP National center for Biotechnology Information NCBI Single nucleotide polymorphisms, small-scale insertions/deletions, polymorphic repetitive elements, and microsatellite variation. The Human Genome Variation Database is to provide an accurate, high utility and ultimately fully comprehensive catalog of normal human gene and genome variation. An integrated resource about how variation in human genes leads to variation in our response to drugs. HGMD Cardiff University Human gene mutation database. ALFRED Yale University A resource of gene frequency data on human population. Ensembl EMBL - European Bioinformatics Institute EBI and the Wellcome Trust Sanger Institute WTSI The Ensembl project provides automated genome annotation and subsequent visualisation of the annotated genomes. JG-SNP Tokyo Metropolitan Geriatric Medical Center Number of autopsy case...
http://snp.ims.u-tokyo.ac.jp/mutation_db_list.html
*  Mutation Types | CK-12 Foundation
Mutation Types. CK-12 Foundation meta http-equiv="refresh" content="1; url=/nojavascript/". Mutation Types. Mutations can affect chromosomes leading to neutral, negative or positive changes. READ. Mutation Types. Surveys different types of mutations. Practice. Practice questions. CK-12 Content. At Grade. Advanced. Levels are CK-12's student achievement levels. At Grade Proficient Students matched to this level have demonstrated competency over challenging subject matter, including subject matter knowledge, application of such knowledge to real-world situations, and analytical skills appropriate to subject matter. Advanced Students matched to this level are ready for material that requires superior performance and mastery. Read. Study Aids. Lesson Plans. Concept Map. Real World. Concept Map. Real World. Read. Mutation Types. by CK-12. // at grade. Surveys different types of mutations. Twitter. Facebook. Email. 5 Read. Mutations Types - Advanced. by CK-12. // advanced. Describes different types of mutations. Tw...
http://ck12.org/biology/Mutation-Types/?by=all&difficulty=all
*  64 bit time t changes
... tech-userlevel archive. [ Date Index ][ Thread Index ][ Old Index ]. 64 bit time t changes. To : tech-userlevel%netbsd.org@localhost Subject : 64 bit time t changes From : christos%zoulas.com@localhost Christos Zoulas Date: Sat, 22 Mar 2008 16:06:10 -0400 EDT. Hello, I am done with the kernel portion of the 64 bit time t changes and I have versioned all the system calls affected so that we can preserve system call level compatibility and it works. I have been running an old userland with it and only netstat seems to be broken. I started working on userland and I saw that there is a very large number of things that are affected: password utmp, utmpx, lastlog, wtmp rpc stuff all time and clock functions utime sigtimedwait mq send and receive all stat stuff again fts again I can do the work, but I am beginning to wonder if this is the time to bump libc, and get rid a lot of the compat code that we've collected through the years. We can use this to sanitize size t across all the platforms and do the rest of ...
http://mail-index.netbsd.org/tech-userlevel/2008/03/22/msg000231.html
*  Mutations - Psychology Wiki
... Edit this Page. Edit. Classic editor. Mutations are changes in the DNA sequence of a cell's genome and are caused by radiation, viruses, transposons and mutagenic chemicals, as well as errors that occur during meiosis or DNA replication. Due to the damaging effects that mutations can have on cells, organisms have evolved mechanisms such as DNA repair to remove mutations. Loss-of-function mutations are the result of gene product having less or no function. In applied genetics it is usual to speak of mutations as either harmful or beneficial. In theoretical population genetics, it is more usual to speak of such mutations as deleterious or advantageous. A nearly neutral mutation is a mutation that may be slightly deleterious or advantageous, although most nearly neutral mutations are slightly deleterious. Missense mutations or nonsynonymous mutations are types of point mutations where a single nucleotide is changed to cause substitution of a different amino acid. A neutral mutation is a mutation that occurs...
http://psychology.wikia.com/wiki/Mutation
*  Welding problems and defects – causes and remedies - PDF Drive
... PDF Drive is a search engine designed to find PDF files. Gay & Lesbian. Welding problems and defects – causes and remedies. Similar PDF files. Pages: 3 Size: 1.12 MB Year: 2009 Welding defects, causes and correction. Pages: 12 Size: 937 KB Year: 2011 Causes and Cures of Common Welding defects. Pages: 37 Size: 1000 KB Year: 2010 Practical examples of welding problems Causes and solutions. Pages: 4 Size: 543 KB Year: 2013 Common Weld Defects - Causes and Cures - Qualimet. Common Weld Defects – Causes and Cures. Pages: 6 Size: 111 KB Year: 2004 Common Incubation Problems : Causes and Remedies - ANRCatalog. Pages: 192 Size: 5.37 MB Year: 2001 THE CALIFORNIA ENERGY CRISIS: IMPACTS, CAUSES, AND REMEDIES. Pages: 192 Size: 5.37 MB Year: 2001 THE CALIFORNIA ENERGY CRISIS: IMPACTS, CAUSES, AND REMEDIES. Pages: 4 Size: 32 KB Year: 2008 Tire wear, causes, how to remedy the potential problems. Tire Safety Part 3 of 4 Tire wear, causes, how to remedy the potential problems, rotation, and at what point does uneven wear...
http://pdfdrive.net/welding-problems-and-defects-causes-and-remedies-e3730978.html
*  genetics - How can synonymous mutations lead to cancerous or tumorous phenotypes? - Biology Stack Ex
genetics - How can synonymous mutations lead to cancerous or tumorous phenotypes. - Biology Stack Exchange. current community. chat blog. Biology. . Biology Meta. your communities. Sign up or log in to customize your list. more stack exchange communities. Stack Exchange. Inbox. Reputation and Badges. sign up log in tour. help. Tour Start here for a quick overview of the site. Help Center Detailed answers to any questions you might have. Meta Discuss the workings and policies of this site. Biology Questions. Tags. Users. Badges. Unanswered. Ask Question. Sign up. Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required. How can synonymous mutations lead to cancerous or tumorous phenotypes. up vote 0 down vote favorite. After analyzing DNA sequences of an oncogene from many human cancer patients, you found that synonymous substitutions occur in a specific codon of this oncogene. Assuming that these synonymous substitution...
http://biology.stackexchange.com/questions/14290/how-can-synonymous-mutations-lead-to-cancerous-or-tumorous-phenotypes
*  Phys.org - gene mutation(... continued page 6)
Phys.org - gene mutation ... 1 week. 1 week. 1 week. genes · breast cancer · mutations · ovarian cancer · cancer cells. Nov 21, 2012 in Cell & Microbiology. Sep 28, 2012 in Plants & Animals. Sep 19, 2012 in Biotechnology. Sep 13, 2012 in Biochemistry. Aug 16, 2012 in Cell & Microbiology. Genetic analyses reveal novel mutations as causes of startle disease. Aug 07, 2012 in Biochemistry. Phys.org -- Scientists do not fully understand how nature uses proteins to develop new materials and minerals, but learning more about the natural processes could lead to bioengineering methods such as the biological synthesis ... Jun 08, 2012 in Biochemistry. In biology, mutations are changes to the nucleotide sequence of the genetic material of an organism. In multicellular organisms with dedicated reproductive cells, mutations can be subdivided into germ line mutations, which can be passed on to descendants through the reproductive cells, and somatic mutations, which involve cells outside the dedicated reproductive group and...
http://phys.org/tags/gene mutation/page6.html
*  New mutations driving deadly skin cancers discovered | Zee News
New mutations driving deadly skin cancers discovered. Zee News. INDIA. SPORTS. other sports. blogs. exclusive. Videos. Bookworm. TV. Pics. HEALTH. EXCLUSIVE. PICS. Health News Diseases Wellness Healthy Eating Fitness Exclusive Ayurveda Low Cal Recipes. News. Health. New mutations driving deadly skin cancers discovered. Washington: Scientists have discovered two new mutations that collectively occur in 71 per cent of malignant melanoma tumours, the most deadly type of skin cancer. Researchers from Dana-Farber Cancer Institute and the Broad Institute in US said the highly "recurrent" mutations - occurring in the tumours of many people - may be the most common mutations in melanoma cells found to date. Researchers said these cancer-associated mutations are the first to be discovered in the vast regions of DNA in cancer cells that do not contain genetic instructions for making proteins. The mutations are located in non-protein-coding DNA that regulates the activity of genes. The newly discovered mutations affect ...
http://zeenews.india.com/news/health/diseases-and-conditions/new-mutations-driving-deadly-skin-cancers-discovered_20435.html
*  Genetic mutation - Conservapedia
... In biology , mutations are changes to the base pair sequence of genetic material either DNA or RNA. Mutations can be caused by copying errors in the genetic material during cell division and by exposure to ultraviolet or ionizing radiation, chemical mutagens , or viruses , or can occur deliberately under cellular control during processes such as meiosis or hypermutation. Small-scale mutations, such as affecting a small gene is one or a few nucleotides, including: Point mutations , often caused by chemicals or malfunction of DNA replication, exchange a single nucleotide for another. Most common is the transition that exchanges a purine for a purine A ↔ G or a pyrimidine for a pyrimidine, C ↔ T. Less common is a transversion , which exchanges a purine for a pyrimidine or a pyrimidine for a purine C/T ↔ A/G. The abnormal FIG-ROS fusion protein has constitutively active kinase activity that causes oncogenic transformation a transformation from normal cells to cancer cells. Loss-of-function mutations are the ...
http://conservapedia.com/index.php?title=Genetic_mutation&redirect=no
*  COSMIC: Catalogue of Somatic Mutations in Cancer - Home Page
... COSMIC. Cell Lines Project. Whole Genomes. Data Download. Data Download. Help. Help. R Resources Key COSMIC resources Cell Lines Project. COSMIC Whole Genomes. cancer gene census. C Expert Curation High quality curation by expert postdoctoral scientists Cancer Gene Census. Curated Genes. Gene Fusions. T Tools Additional tools to explore COSMIC Cancer Browser. Genome Browser. D Data Further details on using COSMIC's content Downloads. Datasheet v74. Summary: Coding Mutations Coding mutation consequence most severe, as predicted by the VEP Genome Browser The COSMIC Genome Browser displays all mutation information across all cancers. In v74 we highlight functionally significant non-coding variants blue. Genome browsing by disease is also available via our Cancer Browser. Coding Mutations 3480051. Fusions 16648. Whole Genomes 22690. For more details, please see the datasheet. Genes Newly Curated in COSMIC v74 Full literature curation across POLE,AXIN2 and KDM6A are included in this release:. KMT2A MLL - 52 n...
http://cancer.sanger.ac.uk/cosmic
*  Medical Xpress - gene mutation
... News tagged with gene mutation. 1 week. 1 week. 1 week. Related topics: genes · breast cancer · mutations · ovarian cancer · cancer cells. Autism spectrum disorders. Genetics. Cancer. Mutations in the BRCA 1 and BRCA 2 genes are very likely to lead to a form of cancer in people who have them. Sep 28, 2015 65 0. Cancer. In a discovery that could lead to more targeted and effective treatments for certain lung and prostate cancers, researchers at the University of Virginia School of Medicine have identified two new cancer-causing gene mutations ... Cancer. Cancer. A rare, deadly form of skin cancer known as desmoplasmic melanoma DM may possess the highest burden of gene mutations of any cancer, suggesting that immunotherapy may be a promising approach for treatment, according to ... Cancer. The startling discovery that hundreds of thousands of Brazilians have a genetic mutation that undermines their ability to resist cancer is helping labs worldwide in their search for new treatments for the disease. Sep 15...
http://medicalxpress.com/tags/gene mutation/sort/rank/1m/
*  Startling plant discovery presents problems for evolution: mutation repair - creation.com
... Creation Magazine. Journal of Creation. Store Books. Creation Magazine Archive Do rabbits chew their cud. COMMENT View Cart items. View Cart View Item. US $25.00 View Item. View Cart View Item. US $10.00 View Item. Second, a paper in Nature describes a plant that can fix its own mutations, apparently without using DNA as a template. These so-called beneficial mutations will be selected for in future generations. While DNA repair mechanisms could be considered irreducibly complex, it can still be argued that natural selection would favor an organism with better DNA repair. This means that, however unlikely, evolutionists can still argue that natural selection could provide for DNA repair to evolve. A mutation repair mechanism can only provide a selective advantage to those individuals that have the mutations and get them fixed. These authors suggested that stress may serve to induce the DNA mutation repair. Since mutations are the raw material of evolution, mechanisms which reduce the number of mutations ...
http://creation.com/startling-plant-discovery-presents-problems-for-evolution-mutation-repair
*  GEN News Highlights Related To | GEN
Tissue-Specific Molecular Biomarker Signatures of Type 2 Diabetes. FDA Nominee Driven by "Data, Data, Data". Jobs Report: Data, Business, and Regulatory Savvy Driving New Hiring. More GEN Exclusives ». Tissue-Specific Molecular Biomarker Signatures of Type 2 Diabetes. FDA Nominee Driven by "Data, Data, Data". Jobs Report: Data, Business, and Regulatory Savvy Driving New Hiring. More GEN Exclusives ». GEN Exclusives More. Linking Phenotypes and Modes of Action Through High-Content Screen Fingerprints The Use of High-Content Screening as... GEN News Highlights Related to Single Gene Mutation May Cause Type 1 Diabetes Growing Surrogate Organs in Lymph Nodes Phase III Results Promising for Diabetes, Gaucher, Atrial Fibrillation Drugs ViaCyte Awarded Funds for Implantable Diabetes Cell Therapy New Diabetes and Angina Link Demonstrated Myriad, Sanofi Forge Potentially $10M Diabetes Collab NGM Inks Diabetes Deal with Janssen Boy or Girl. Beyond X and Y Setback, and Success, for BI-Lilly Diabetes Alliance Novo Nordis...
http://genengnews.com/more/related/gen-news-highlights/4/30567/?page=6
*  AD&FTD Mutation Database
AD FTD Mutation Database. Alzheimer Disease Frontotemporal Dementia Mutation Database Home. AD FTDMDB. Links. About. Lookup Mutations. By Gene. By Phenotype. By Publication. Latest Updates. Statistics. Per Gene. Per Exon. Per Domain. Submit Mutations. PSEN1 Ser365Tyr Mutation Details Table Legend. Gene PSEN1 Name g.63825C>A relative to Met1 in AF109907.1 g.80437C>A relative to nt1 in NG 007386.2 Alias Ser365Tyr Description Point mutation in coding region predicting an amino acid substitution Codon Change From TCC to TAC dbSNP ID rs63750941 Details Genomic. cDNA. Protein. Observed. c.1094C>A. Predicted g.63825C>A. p.S365Y Region EX10 CDS HL-VI b. Pathogenecity CADD v1.2 score: phred = 24.5 ; raw = 4.113688 Guerreiro classification: Notes Observed in 1 patient who also carries the PSEN1 Met146Val mutation. Phenotype Alzheimer Disease Pathogenic nature unclear. Frequency 1 Family. Function No Functional data available. Citations Rogaeva EA, Neurology 57: 621-625, 2001. Citation Details. Added: September 11, 2001...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=121
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations psen pro ser mutation details table legend gene psen name g c t relative to met in af g c t relative to nt in ng alias pro ser description point mutation in coding region predicting an amino acid substitution codon change from cca to tca dbsnp id rs details genomic cdna protein observed g c t c c t predicted p p s region ex cds hl vi a pathogenecity cadd v score phred raw guerreiro classification phenotype alzheimer disease mean of mean onset ages y frequency family function summary table showing mean of n reports a a cos x function details citations clark rf nature genetics hutton m neuroreport palmer ms human mutation citation details added december last modified april id note when using ad ftdmdb please consult the how to cite page for information on how to cite ad ftdmdb i...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=35
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations psen val phe mutation details table legend gene psen name g g t relative to met in af g g t relative to nt in ng alias val phe description point mutation in coding region predicting an amino acid substitution codon change from gtt to ttt dbsnp id rs details genomic cdna protein observed g g t predicted c g t p v f region ex cds tm vi pathogenecity cadd v score phred raw guerreiro classification phenotype alzheimer disease spastic paraparesis mean of mean onset ages y mean of mean ages at death y frequency families function no functional data available citations farlow mr neurobiology of aging supp s farlow mr alzheimer s disease advances in etiology pathogenesis and therapeutics chapter rogaeva ea neurology miravalle l neurobiology of aging s s citation details added july last...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=92
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations psen met ile mutation details table legend gene psen name g g a relative to met in af g g a relative to nt in ng alias met ile description point mutation in coding region predicting an amino acid substitution codon change from atg to ata dbsnp id rs details genomic cdna protein observed g g a predicted c g a p m i region ex cds tm ii pathogenecity cadd v score phred raw guerreiro classification phenotype alzheimer disease mean of mean onset ages y mean of mean ages at death y frequency families function no functional data available citations cervenakova l american journal of human genetics supp a jorgensen p clinical genetics janssen jc neurobiology of aging s s janssen jc neurology lindquist s clinical genetics citation details added december last modified august id note when...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=87
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations psen glu lys mutation details table legend gene psen name g g a relative to met in af g g a relative to nt in ng alias glu lys description point mutation in coding region predicting an amino acid substitution codon change from gaa to aaa dbsnp id rs details genomic cdna protein observed g g a predicted c g a p e k region ex cds hl i pathogenecity cadd v score phred raw guerreiro classification definite pathogenic phenotype alzheimer disease mean of mean onset ages y frequency families function summary table showing mean of n reports a a cos x function details citations hutton m neuroreport lindquist s clinical genetics citation details added december last modified august id note when using ad ftdmdb please consult the how to cite page for information on how to cite ad ftdmdb i...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=11
*  AD&FTD Mutation Database
AD FTD Mutation Database. Alzheimer Disease Frontotemporal Dementia Mutation Database Home. AD FTDMDB. Links. About. Lookup Mutations. By Gene. By Phenotype. By Publication. Latest Updates. Statistics. Per Gene. Per Exon. Per Domain. Submit Mutations. PSEN1 Ala136Gly Mutation Details Table Legend. Gene PSEN1 Name g.25610C>G relative to Met1 in AF109907.1 g.42164C>G relative to nt1 in NG 007386.2 Alias Ala136Gly Description Point mutation in coding region predicting an amino acid substitution Codon Change From GCT to GGT dbSNP ID rs41345849 Details Genomic. cDNA. Protein. Observed g.25610C>G. Predicted. c.407C>G p.A136G Region EX5 CDS TM-II. Pathogenecity CADD v1.2 score: phred = 24.3 ; raw = 4.01346 Guerreiro classification:. Phenotype Alzheimer Disease. Frequency 1 Family. Function No Functional data available. Citations Fang BY, Zhonghua Yi Xue Za Zhi 87: 336-340, 2007. Citation Details. Added: December 9, 2008 Last Modified: May 12, 2009 ID: 463 Note. When using AD FTDMDB, please consult the How To Cite pa...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=463
*  AD&FTD Mutation Database
AD FTD Mutation Database. Alzheimer Disease Frontotemporal Dementia Mutation Database. Home. AD FTDMDB. Links. About. Lookup Mutations. By Gene. By Phenotype. By Publication. Latest Updates. Statistics. Per Gene. Per Exon. Per Domain. Submit Mutations. Mutations in PSEN1. Mutation. Exon / Domain. Citations. 1 PSEN1 Asn32 g.22781T>C. Pathogenic nature unclear. EX4 N-Term. Scacchi R, 2007. 2 PSEN1 Arg35Gln g.22789G>A. Not pathogenic. EX4 N-Term. Rogaeva EA, 2001 Raux G, 2005 Guerreiro RJ, 2010. 3 PSEN1 Ala79Val g.22921C>T. EX4 N-Term. Cruts M, 1998 Finckh U, 2000 Rogaeva EA, 2001 Miravalle L, 2002 Kauwe JS, 2007. 4 PSEN1 Val82Leu g.22929G>C. EX4 TM-I. Campion D, 1995 Campion D, 1999. 5 PSEN1 I83/M84 g.22932 22937delATCATG. EX4 TM-I. Houlden H, 2000 Steiner H, 2001. 6 PSEN1 Leu85Pro g.22939T>C. EX4 TM-I. Ataka S, 2004. 7 PSEN1 Val89Leu g.22950G>T. EX4 TM-I. Queralt R, 2002 Lleo A, 2002. 8 PSEN1 Cys92Ser g.22960G>C. EX4 TM-I. Sorbi S, 2002 Tedde A, 2003. 9 PSEN1 Val94Met g.22965G>A. EX4 TM-I. Jacquier M, 2000 Ara...
http://molgen.ua.ac.be/ADMutations/default.cfm?MT=1&ML=1&Page=MutByQuery&Query=tblContexts.GeneSymbol In ('PSEN1')&Selection=Gene In (PSEN1
*  AD&FTD Mutation Database
AD FTD Mutation Database. Alzheimer Disease Frontotemporal Dementia Mutation Database Home. AD FTDMDB. Links. About. Lookup Mutations. By Gene. By Phenotype. By Publication. Latest Updates. Statistics. Per Gene. Per Exon. Per Domain. Submit Mutations. PSEN1 Asn135Ser Mutation Details Table Legend. Gene PSEN1 Name g.25607A>G relative to Met1 in AF109907.1 g.42161A>G relative to nt1 in NG 007386.2 Alias Asn135Ser Description Point mutation in coding region predicting an amino acid substitution Codon Change From AAT to AGT dbSNP ID rs63751278 Details Genomic. cDNA. Protein. Observed g.25607A>G. Predicted. c.404A>G p.N135S Region EX5 CDS TM-II. Pathogenecity CADD v1.2 score: phred = 25.6 ; raw = 4.642778 Guerreiro classification:. Phenotype Alzheimer Disease / Epilepsy / Spastic Paraparesis Mean of Mean Onset Ages: 33.4y Mean of Mean Ages at Death: 38.8y. Frequency 2 Families. Function No Functional data available. Citations Finckh U, Neurogenetics 6: 85-89, 2005 Rudzinski LA, Alzheimer disease and associated dis...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=242
*  AD&FTD Mutation Database
AD FTD Mutation Database. Alzheimer Disease Frontotemporal Dementia Mutation Database Home. AD FTDMDB. Links. About. Lookup Mutations. By Gene. By Phenotype. By Publication. Latest Updates. Statistics. Per Gene. Per Exon. Per Domain. Submit Mutations. PSEN2 Ser175Cys Mutation Details Table Legend. Gene PSEN2 Name g.6210C>G relative to Met1 in U50871.1 g.22545C>G relative to nt1 in NG 007381.1 Alias Ser175Cys Description Point mutation in coding region predicting an amino acid substitution Codon Change From TCT to TGT Details Genomic. cDNA. Protein. Observed g.6210C>G. Predicted. c.524C>G p.S175C Region EX6 CDS TM-III. Pathogenecity CADD v1.2 score: phred = 31 ; raw = 5.624295 Guerreiro classification:. Phenotype Alzheimer Disease Mean of Mean Onset Ages: 60.5y Mean of Mean Ages at Death: 70.0y. Frequency 1 Family. Function No Functional data available. Citations Piscopo P, Alzheimer's & Dementia 4 Supp 2: T595, 2008 Piscopo P, Personal Communication :, 2008 Piscopo P, Journal of Alzheimer's Disease 20: 43-47,...
http://molgen.ua.ac.be/FTDMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=457
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations psen leu pro mutation details table legend gene psen name g t c relative to met in af g t c relative to nt in ng alias leu pro description point mutation in coding region predicting an amino acid substitution codon change from ctc to ccc details genomic cdna protein observed g t c predicted c t c p l p region ex cds hl vi ma pathogenecity cadd v score phred raw guerreiro classification phenotype alzheimer disease caa mean of mean onset ages y mean of mean ages at death y frequency family function no functional data available citations sánchez valle r european journal of neurology citation details added december id note when using ad ftdmdb please consult the how to cite page for information on how to cite ad ftdmdb in your publication top back ad ftdmdb home...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=400
*  AD&FTD Mutation Database
AD FTD Mutation Database. Alzheimer Disease Frontotemporal Dementia Mutation Database Home. AD FTDMDB. Links. About. Lookup Mutations. By Gene. By Phenotype. By Publication. Latest Updates. Statistics. Per Gene. Per Exon. Per Domain. Submit Mutations. PSEN1 Leu282Val Mutation Details Table Legend. Gene PSEN1 Name g.50029C>G relative to Met1 in AF109907.1 g.66635C>G relative to nt1 in NG 007386.2 Alias Leu282Val Description Point mutation in coding region predicting an amino acid substitution Codon Change From CTT to GTT dbSNP ID rs63749937 Details Genomic. cDNA. Protein. Observed g.50029C>G. Predicted. c.844C>G p.L282V Region EX8 CDS HL-VI MA. Pathogenecity CADD v1.2 score: phred = 26.1 ; raw = 4.802401 Guerreiro classification:. Phenotype Alzheimer Disease / CAA Mean of Mean Onset Ages: 44.3y Mean of Mean Ages at Death: 53.5y. Frequency 1 Family. Function Summary table showing mean of n reports A 40. A 42. A 42 /A. A 42 /A 40. HEK293. 2.2x 1 = 1 2.3x 1 2.6x 3 brain. 1.6x 1 1.3x 1 Function Details. Citations ...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=129
*  Diverse somatic mutation patterns and pathway alterations in human cancers (PDF Download Available)
Nature. DOI: 10.1038/nature09208 Source: PubMed. Statistical analysis identified 77 significantly mutated genes including protein kinases, G-protein-coupled receptors such as GRM8, BAI3, AGTRL1 also called APLNR and LPHN3, and other druggable targets. Here we report the identification of 2,576 somatic mutations across senting 1,507 coding genes from 441 tumours comprising breast, lung, ovarian and prostate cancer types and subtypes. BAI1 and BAI2 were also mutated in breast, lung and ovarian cancers at a lower frequency Fig. In particular, GNAS—the G-protein a subunit, known to be associated with mul- tiple human diseases, including some cancers3,19—besides being mutated at R201, was also found to be amplified in 12% 6 of 49 ofovarian cancers, 20% 10of50 ofHER21breast cancers and13% 7 of 53 of HR1breast cancers Fig. Whereas the presence of homozygous MAP2K4 deletions G49 R T118 T14 I869 A1024 G1404 C189C819 R1050R1124 C1148 M1258 N1475 D1449 P1510 Y1479 F1378T420 A442 W461 G543G586 I M206 V W215 C I574 V I575...
http://researchgate.net/publication/45406823_Diverse_somatic_mutation_patterns_and_pathway_alterations_in_human_cancers
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations psen met val mutation details table legend gene psen name g a g relative to met in af g a g relative to nt in ng alias met val description point mutation in coding region predicting an amino acid substitution codon change from atg to gtg dbsnp id rs details genomic cdna protein observed g a g c a g predicted p m v region ex cds tm ii pathogenecity cadd v score phred raw guerreiro classification definite pathogenic phenotype alzheimer disease mean of mean onset ages y frequency families function summary table showing mean of n reports a a cos x function details citations clark rf nature genetics cervenakova l american journal of human genetics supp a rogaeva ea neurology citation details added december last modified april id note when using ad ftdmdb please consult the how to c...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=19
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations psen tyr cys mutation details table legend gene psen name g a g relative to met in af g a g relative to nt in ng alias tyr cys description point mutation in coding region predicting an amino acid substitution codon change from tat to tgt dbsnp id rs details genomic cdna protein observed g a g predicted c a g p y c region ex cds tm ii pathogenecity cadd v score phred raw guerreiro classification phenotype alzheimer disease mean of mean onset ages y frequency family function no functional data available citations janssen jc neurobiology of aging s s janssen jc neurology citation details added august last modified march id note when using ad ftdmdb please consult the how to cite page for information on how to cite ad ftdmdb in your publication top back ad ftdmdb home...
http://molgen.ua.ac.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=143
*  AD&FTD Mutation Database
ad ftd mutation database alzheimer disease frontotemporal dementia mutation database home ad ftdmdb links about lookup mutations by gene by phenotype by publication latest updates statistics per gene per exon per domain submit mutations app thr ala iranian app mutation details table legend gene app name g a g relative to met in d g a g relative to nt in ng alias thr ala iranian app description point mutation in coding region predicting an amino acid substitution codon change from aca to gca dbsnp id rs details genomic cdna protein observed g a g predicted c a g p t a region ex cds tm i pathogenecity cadd v score phred raw guerreiro classification phenotype alzheimer disease epilepsy mean of mean onset ages y mean of mean ages at death y frequency families function no functional data available citations pasalar p neurology zekanowski c experimental neurology lindquist sg journal of the neurological sciences lindquist s clinical genetics citation details added june last modified august id note when using ad ftd...
http://molgen.vib-ua.be/ADMutations/Default.cfm?MT=1&ML=0&Page=Mutations&ID=133
*  AD&FTD Mutation Database
AD FTD Mutation Database. Alzheimer Disease Frontotemporal Dementia Mutation Database. Home. AD FTDMDB. Links. About. Lookup Mutations. By Gene. By Phenotype. By Publication. Latest Updates. Statistics. Per Gene. Per Exon. Per Domain. Submit Mutations. Mutations in PSEN2. Mutation. Exon / Domain. Citations. 1 PSEN2 Arg29His g.86G>A. Not pathogenic. EX3 N-Term. Guerreiro RJ, 2010. 2 PSEN2 Gly34Ser g.100G>A. Pathogenic nature unclear. EX3 N-Term. Sleegers K, 2004. 3 PSEN2 Arg62Cys g.1838C>T. Pathogenic nature unclear. EX4 N-Term. Sleegers K, 2004 Ertekin-Taner N, 2008 Brouwers N, 2008. 4 PSEN2 Arg62His g.1839G>A. Pathogenic nature unclear. EX4 N-Term. Cruts M, 1998 Sleegers K, 2004 Ertekin-Taner N, 2008 Gallo M, 2009 Guerreiro RJ, 2010 Dobricic V, 2012. 5 PSEN2 Pro69Ala g.1849C>G. Pathogenic nature unclear. EX4 N-Term. Dobricic V, 2012. 6 PSEN2 Arg71Trp g.1855C>T. Pathogenic nature unclear. EX4 N-Term. Sleegers K, 2004 Brouwers N, 2008 Guerreiro RJ, 2010. 7 PSEN2 Ala85Val g.1908C>T. Ex4 N-Term. Piscopo P, 2005 ...
http://molgen.ua.ac.be/ADmutations/Default.cfm?MT=1&ML=1&Page=MutByQuery&Query=tblContexts.ID=2&Selection=Gene = PSEN2
*  Category:SWL/genetic defect results in disease
category swl genetic defect results in disease category swl genetic defect results in disease category swl definition this category describes the collection of genes with defects caused by mutations known to cause disease for example defects in genes like kv caused by mutations can have the consequence of producing diseases like episodic ataxia external formal definitions...
https://en.wikipedia.org/wiki/Category:SWL/genetic_defect_results_in_disease
*  Biology-Online • View topic - The Implausible Engines of Evolution
41 posts. -facts, observed events, plausible explanations, and solid evidence. Death Adder Posts: 99 Joined: Wed Oct 05, 2011 2:13 am. The probability of a mutation being positive is also extremely low and very close to impossible, and has not been shown or observed to increase at the passage of time. Also, the probability of positive mutations does not increase the more mutations occur in a population. However, I would like to know where it has been observed that mutations are dominant my thing with evolution is that evolution has not been observed in the environment or replicated in the environment- I will post on Life in a Tube in the near future. 3 Since when has a mutation in one species been observed, which is not unlikely to occur, and then even more unlikely to be positive. The probability of a positive mutation does not increase the more mutations occur in a population, and it does not increase with time. Also, the probability of positive mutations does not increase the more mutations occur in a popu...
http://biology-online.org/biology-forum/about22857.html?p=135104&hilit=Genes
*  Biology-Online • View topic - The Implausible Engines of Evolution
41 posts. -facts, observed events, plausible explanations, and solid evidence. Death Adder Posts: 99 Joined: Wed Oct 05, 2011 2:13 am. The probability of a mutation being positive is also extremely low and very close to impossible, and has not been shown or observed to increase at the passage of time. Also, the probability of positive mutations does not increase the more mutations occur in a population. However, I would like to know where it has been observed that mutations are dominant my thing with evolution is that evolution has not been observed in the environment or replicated in the environment- I will post on Life in a Tube in the near future. 3 Since when has a mutation in one species been observed, which is not unlikely to occur, and then even more unlikely to be positive. The probability of a positive mutation does not increase the more mutations occur in a population, and it does not increase with time. Also, the probability of positive mutations does not increase the more mutations occur in a popu...
http://biology-online.org/biology-forum/about22857.html?p=135118&hilit=dehydroascorbic acid
*  temp sensitive mutant proteins
... hinayana bawagan bawagan at umdnj edu sat may est previous message trans factor program next message fluorescent proteins bionet molbio proteins fluorescent is ready messages sorted by i am not a protein person but my research involves the use of temperature sensitive mutant alleles of an essential yeast gene i would like to read up on the principles underlying the phenotype of temperature sensitiveness of mutant proteins so i would like to solicit articles on this subject thank you very much previous message trans factor program next message fluorescent proteins bionet molbio proteins fluorescent is ready messages sorted by more information about the proteins mailing list...
http://bio.net/bionet/mm/proteins/1995-May/002707.html
*  Newest 'mutations' Questions - Biology Stack Exchange
Newest 'mutations' Questions - Biology Stack Exchange. Help Center Detailed answers to any questions you might have. Biology Questions. Tagged Questions info newest frequent votes active unanswered. 0 votes. 0 answers. 23 views. genetics human-genetics mutations human-genome asked Oct 2 at 19:14. 1 answer. 38 views. genetics pathology mutations population-genetics hardy-weinberg asked Sep 17 at 20:53. 3 0 votes. 1 answer. 29 views. 2 votes. 0 answers. 26 views. cell-biology mutations stress asked Sep 1 at 23:47. 7 2 votes. 0 answers. 25 views. molecular-biology cell-biology microbiology mutations asked Aug 25 at 22:05. 0 answers. 25 views. genetics dna mutations asked Aug 25 at 18:45. 1 2 votes. 1 answer. 44 views. 5 0 votes. 1 answer. 52 views. evolution genetics molecular-genetics mutations recombination asked Aug 17 at 1:57. Remi.b 16.6k. 8 votes. 2 answers. 122 views. evolution reproduction natural-selection mutations asked Aug 5 at 18:18. genetics cell-biology homework mutations yeast asked Jun 2...
http://biology.stackexchange.com/questions/tagged/mutations
*  genetics - How do mutations come to be shared by all cells? - Biology Stack Exchange
- Biology Stack Exchange. Biology Meta. more stack exchange communities. Stack Exchange. Help Center Detailed answers to any questions you might have. Biology Questions. Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. the other cells in our body would not have the same mutations. genetics dna share. asked Apr 29 '13 at 2:16. This usually happens when the mutations occur at an early stage of development, such that a precursor cell with the mutation gives rise to all other cells in the body. So we have lots of type 1 and few type 2. When type 2 divide they make one type 1 cell and one type 2 cell, so type 2 cells never run out. If smoke causes a mutation in type 1 cells generally they're okay because they'll die before enough mutations occur. Now if it occurs in Type 2 cells every subsequent type 1 or type 2 cell that cell makes is mutated. The last thing you mentioned are mutations that occur to eggs and sperm. One cell makes sperm and a sperm maker cell. ...
http://biology.stackexchange.com/questions/8127/how-do-mutations-come-to-be-shared-by-all-cells?answertab=active
*  Startling plant discovery presents problems for evolution - creation.com
Creation Magazine. Journal of Creation. Store Books. Creation Magazine Archive Do rabbits chew their cud. COMMENT View Cart items. Article from: Journal of Creation 19 2 :3 4 August 2005 Browse this issue Subscribe to Journal of Creation. View Cart View Item. US $25.00 View Item. View Cart View Item. US $10.00 View Item. First published: Journal of Creation 19 2 :3 4 August 2005 Browse this issue Subscribe to Journal of Creation. It describes a plant that can fix its own mutations, apparently without using DNA as a template. The plant Arabidopsis thaliana can fix its own mutations without using DNA as a template. These so-called beneficial mutations will be selected for in future generations. This means that, however unlikely, evolutionists can still argue that natural selection could provide for DNA repair to evolve. A mutation repair mechanism can only provide a selective advantage to those individuals that have the mutations and get them fixed. Since mutations are the raw material of evolution, mechanisms ...
http://creation.com/startling-plant-discovery-presents-problems-for-evolution
*  Hundreds of genetic mutations found in healthy blood of a supercentenarian
... April 23, 2014 Hundreds of genetic mutations found in healthy blood of a supercentenarian April 23, 2014. In a study published online in Genome Research, researchers detected over 400 mutations in healthy blood cells of a 115-year-old woman, suggesting that lesions at these sites are largely harmless over the course of a lifetime. Hundreds of mutations have been found in patients with blood cancers such as acute myeloid leukemia AML, but it is unclear whether healthy white blood cells also harbor mutations. In this new study, the authors used whole genome sequencing of white blood cells from a supercentenarian woman to determine if, over a long lifetime, mutations accumulate in healthy white blood cells. The white blood cell telomeres were extremely short. Medical Xpress on facebook. Medical Xpress —An international team of researchers working out of the University of Toronto has found that one type of rare leukemia appears to get its start in stem cells. Cancer metabolism drug AG-221 shows clinical acti...
http://medicalxpress.com/news/2014-04-hundreds-genetic-mutations-healthy-blood.html
*  Mutant protein
... a mutant protein is the protein product encoded by a gene with mutation mutated protein can have single amino acid change minor but still in many cases significant change leading to disease or wide range amino acid changes by e g truncation of c terminus after introducing premature stop codon see also missense mutation nonsense mutation point mutation single nucleotide polymorphism references category articles created via the article wizard category proteins category genetics category mutation...
https://en.wikipedia.org/wiki/Mutant_protein
*  .. Return to Strain Description
CGSC Strain#: 4273 Strain Designation: JC1552      Source of Strain: A.J. Clark Sex: F- Chromosomal Markers: leuB6 Am, fhuA2::IS2, lacY1, glnX44 AS, gal-6, -, trp-31, hisG1, argG6, rpsL104, malT1 R, xyl-7, mtlA2, metB1 Strain Comments:. leuB6 Am -- Suppressed by serU suppressor supH glnX44 AS -- Mutation is a C to T transition at nucleotide 34 3rd position of the anticodon hisG1 -- This mutation has been reported as either a frameshift or a 36 nt deletion fhuA2::IS2 was formerly called fhuA2 glnX44 AS was formerly called supE44 glnX44 AS was formerly called su + II. glnX44 AS was formerly called glnV44 xyl-7 was formerly called xylA7 = strep-resistant ::IS2 = Insertion of IS2 Am = amber UAG mutation AS = amber UAG suppressor LamR = Lambda-resistant References: Low, K.B. 1973. Rapid mapping of conditional and auxotrophic mutants of Escherichia coli K-12. J.Bacteriol. 113:798-812. Return to Strain Description....
http://cgsc.biology.yale.edu/StrainRpt.php?ID=11445
*  .. Return to Strain Description
CGSC Strain#: 5222 Strain Designation: N23-53      Source of Strain: H. Ogawa Sex: F- Chromosomal Markers: thr-24, galT23, -, trp-56, recA41, IN rrnD-rrnE 1, rpsL178 strR, phe-4, tyr-7 Strain Comments: The inversion comes from strain W3110, an ancestor of N23-53. galT23 -- : This is the standard gal 6 of Morse & Lederberg. IN rrnD-rrnE 1 -- Inverts the region between rrnD 73.74 min and rrnE 90.66 min strR = streptomycin resist. References: Ogawa, H, K Shimada, J Tomizawa 1968. Studies on radiation-sensitive mutants of E. coli. I Mutants defective in the repair synthesis. Mol. Gen. Genet. 101 3 :227-44. Return to Strain Description....
http://cgsc.biology.yale.edu/StrainRpt.php?ID=7637
*  .. Return to Strain Description
CGSC Strain#: 3513 Strain Designation: 188E      Source of Strain: J.A. Wechsler Sex: Hfr Point of Origin#: Map Position:. Chromosomal Markers: glnX44 AS, purF1, xyl-7, ilvD188 Oc, argH1 Strain Comments:. glnX44 AS -- Mutation is a C to T transition at nucleotide 34 3rd position of the anticodon purF1 -- is a very stable mutation and may be an intragenic deletion. glnX44 AS was formerly called supE44 glnX44 AS was formerly called su + II. glnX44 AS was formerly called glnV44 xyl-7 was formerly called xylA7 AS = amber UAG suppressor Oc = ochre UAA mutation References: Wechsler, J.A. 1969. Antipolarity in the ilv operon of Escherichia coli K-12. J.Bacteriol. 98:1179-1194. Return to Strain Description....
http://cgsc.biology.yale.edu/StrainRpt.php?ID=17193
*  Prophylactic administration of prothrombin complex concentrates for congenital prothrombin deficienc
... y with a novel frameshift mutation, prothrombin saitama - Seki - 2012 - Pediatric Blood Cancer - Wiley Online Library. Skip to Main Content. Log in / Register. Log In. E-Mail Address. Password. Forgotten Password. Remember Me. Register. Institutional Login. Home. Oncology Radiotherapy. Oncology Radiotherapy. Pediatric Blood Cancer. Vol 60 Issue 3. Abstract. JOURNAL TOOLS Get New Content Alerts. Get RSS feed. Save to My Profile. Get Sample Copy. Recommend to Your Librarian. JOURNAL MENU Journal Home FIND ISSUES Current Issue. All Issues FIND ARTICLES Early View. GET ACCESS Subscribe / Renew. FOR CONTRIBUTORS OnlineOpen. Author Guidelines. Submit an Article. ABOUT THIS JOURNAL Society Information. News. Overview. Editorial Board. Permissions. Advertise. Contact. SPECIAL FEATURES Get Email Alerts. ASPHO Abstracts - 2013. Histiocyte Society Abstracts 2011. ASPHO Abstracts - 2010. SIOP 2010 Online Abstracts. ASPHO Abstracts - 2008. SIOP Abstracts - 2008. Wiley Job Network. Professional Opportunities. BloodMed....
http://onlinelibrary.wiley.com/doi/10.1002/pbc.24387/suppinfo
*  frameshift - definition and meaning
Word of the day. Random word. Log in or Sign up. frameshift love. Help Wordnik hunt for a million missing words by backing our Kickstarter. frameshift. from Wiktionary, Creative Commons Attribution/Share-Alike License. n frameshift mutation. of, pertaining to, or causing a type of mutation consisting of the insertion or deletion of one or more nucleotides in the nucleic acid structure of a gene, when the number of base pairs inserted or deleted is not a multiple of three. If the addition or deletion occurs in multiples of three, the unaffected nucleotides in the genome remain in the proper order "frame" to be correctly translated into protein; in such cases of insertions or deletions not causing a frame shift, a functional though altered protein may be produced by the organism. Frameshift mutations cause more profound changes in the composition of the protein resulting from translation of the mutated gene. Etymologies. Sorry, no etymologies found. GU anomalies syndrome: These individuals usually carry changes...
https://wordnik.com/words/frameshift
*  Frameshift mutation
350px|thumb|Different types of indel mutation. A 'frameshift mutation' also called a 'framing error' or a 'reading frame shift' is a genetic mutation caused by indel s insertions or deletions of a number of nucleotide s in a DNA sequence that is not divisible by three. Due to the triplet nature of gene expression by codon s, the insertion or deletion can change the reading frame the grouping of the codons, resulting in a completely different translation from the original. A frameshift mutation will in general cause the reading of the codons after the mutation to code for different amino acids. Mechanism Genetic or Environmental. Diseases Cancer. File:Translation-genetics.png|200px|thumb|The translation process After DNA replication, the reading of a selected section of genetic information is accomplished by transcription. Genetic code. Image:RNA-codons-aminoacids.svg|300px A codon is a set of three nucleotides, a triplet that code for a certain amino acid. 5 Codons are key to translation of genetic informatio...
https://en.wikipedia.org/wiki/Frameshift_mutation
*  CDFD :: Publications of CDFD
... Home. Site Map. Contact Us. Hindi Version. About Us. Services. Research. Publications. Group Leaders. RTI Act. Awards Honours. Careers. Web Mail. 2015. 2014. 2013. 2012. 2011. 2010. 2009. 2008. 2007. 2006. 2005. 2004. 2003. 2002. 2001. 2000. 1999. Home. Publications of CDFD. Publications of CDFD. 2015. Thota S.G. and Bhandari R. The emerging roles of inositol pyrophosphates in eukaryotic cell physiology. J Biosci. 2015 40, 593-605. Thota S.G., Unnikannan C.P., Thampatty S.R., Manorama R. and Bhandari R. Inositol pyrophosphates regulate RNA polymerase I-mediated rRNA transcription in Saccharomyces cerevisiae. Biochemical Journal 2015 466, 105-114. Das Bhowmik A Dalal A 2015. Whole exome sequencing identifies a novel frameshift mutation in GPC3 gene in a patient with overgrowth syndrome. Gene DOI:10.1016/j.gene.2015.08.053 in press Aggarwal S, Mohamed Nurul Jain S, Das Bhowmik A, Tandon A, Dalal A 2015. Molecular studies on parents after autopsy identify recombinant GBA gene in a case of Gaucher Disease wi...
http://hansa.cdfd.org.in/inside htmls/publications.html
*  Insertion (genetics)
thumb|300px|An illustration of an insertion at chromosome level. In genetics, an 'insertion' also called an 'insertion mutation' is the addition of one or more nucleotide base pair s into a DNA sequence. This can often happen in microsatellite regions due to the DNA polymerase slipping. Insertions can be anywhere in size from one base pair incorrectly inserted into a DNA sequence to a section of one chromosome inserted into another. The mechanism of the smallest single base insertion mutations is believed to be through base-pair separation between the template and primer strands followed by non-neighbor base stacking, which can occur locally within the DNA polymerase active site. 3 Effects See also References Further reading. A frameshift mutation, an alteration in the normal reading frame of a gene, results if the number of inserted nucleotides is not divisible by three, i.e., the number of nucleotides per codon. Frameshift mutations will alter all the amino acids encoded by the gene following the mutation. ...
https://en.wikipedia.org/wiki/Insertion_(genetics)
*  Mutants and Mutations
... dna damage and repair mechanisms of dna damage mechanisms of dna repair repair of dna modifications photolyase ada repair of dna synthesis errors proofreading by dna polymerase mismatch repair by muthsl repair of replication fork barriers recombinational repair reca recfor recbcd translesion synthesis umucd mutator strains mutations types of mutations missense mutants properties of amino acids identifying missense mutants frame shift mutations deletion and insertion mutations mutation rates mutagens examples of some useful mutagens mutagen dose the zen of mutagenesis mutants genetic nomenclature strategies for finding mutants selections antibiotics screens enrichments...
http://sci.sdsu.edu/~smaloy/MicrobialGenetics/topics/mutations/
*  Submit a Revision
pNL-GFP-RRE was constructed by complete deletion of all HIV ORFs of pNL4-3. by replacing the 8.1 kb BssHII-BlpI fragment of the HIV-1 genomes with an insert containing the GFP ORF and the HIV-1 Rev-responsive element RRE including the HIV-1 sequence immediately following the BssHII site and the first 336 nucleotides of the gag ORF the gag reading frame was disrupted by a frame shift mutation at the ClaI site by blunt end ligation , the GFP ORF was derived from pIRES-hrGFP-1a Stratagene by PCR amplification 5' CTCGAAATTAACCCTCACTAAAGG 3'; 5'ATCGTGTACGGCCGAATTGGGTACACTTACCTG 3' , and the fragment containing RRE corresponding to position 7612 to 8469 of the HIV-1NL4-3 genome. pNL-GFP-RRE- SA was constructed by insertion of a PCR fragment into the NotI-SmaI site of pNL-GFP-RRE, in front of the GFP ORF. Following cDNA synthesis, PCR was carried out using primer 5'TAATCGGCCGAACAGGGACTTGAAAGCGAAAG3' and 5'CAGGCACAAGCAGCATTGTTAG 3' to amplify spliced lentiviral transcripts, and primer 5' TAATCGGCCGAACAGGGACTTGAAAGCGA...
http://biology-online.org/kb/revision.php?p_id=11465&a_id=4524
*  Characterization of the P373L E-cadherin germline missense mutation and implication for clinical man
European journal of surgical oncology: the journal of the European Society of Surgical Oncology and the British Association of Surgical Oncology. Impact Factor: 3.01. ABSTRACT Hereditary diffuse gastric cancer HDGC is a cancer susceptibility syndrome caused by E-cadherin germline mutations. A new germline missense mutation P373L was recently identified in a HDGC Italian family. Corso G, Marrelli D, Pascale V, Vindigni C, Roviello FFrequency of CDH1 germline mutations in gastric carcinoma coming from high- and low-risk areas: metanalysis and systematic review of the literature. The goal of this study was to assess the worldwide frequency of CDH1 germline mutations in gastric cancers coming from low- and high-risk areas. A total of 122 E-cadherin germline mutations have been identified; the majority 87.5% occurred in gastric cancers coming from low-risk areas. In high-risk areas, we identified 16 mutations in which missense mutations were predominant. We verified a significant association between the mutation f...
http://researchgate.net/publication/6393163_Characterization_of_the_P373L_E-cadherin_germline_missense_mutation_and_implication_for_clinical_management
*  PMS2
1 Function Mismatch repair and endonuclease activity. 3 Mismatch repair and endonuclease activity. Heterozygous germline mutations in DNA mismatch repair genes like PMS2 lead to autosomal dominant Lynch syndrome. Image:Sequential sections of a colon crypt showing normal high expression of PMS2 A, ERCC1 B and ERCC4 C .jpg.tif. DNA repair, involving high expression of PMS2, ERCC1 and ERCC4 XPF proteins, appears to be very active in colon crypts in normal, non- neoplastic colonic epithelium. In the case of PMS2, the expression level in normal colonic epithelium is high in 77% to 100% of crypts. Similar expression of ERCC4 XPF and ERCC1 occurs in the thousands of enterocytes in each colonic crypt of the normal colonic epithelium. About 88% of cells of epithelial origin in colon cancers, and about 50% of the colon crypts in the epithelium within 10 cm adjacent to cancers in the field defects from which the cancers likely arose have reduced or absent expression of PMS2. In 16 cancers Pms2 was deficient even though ...
https://en.wikipedia.org/wiki/PMS2
*  Germline STAT 1 Mutation
germline stat mutation germline stat mutation interferons induce the formation of two transcriptional activators gamma activating factor gaf and interferon stimulated gamma factor isgf a natural heterozygous germline stat mutation associated with susceptibility to mycobacterial but not viral disease was found in two unrelated patients with unexplained mycobacterial disease dupuis s dargemont c fieschi c et al impairment of mycobacterial but not viral immunity by a germline human stat mutation science this mutation caused a loss of gaf and isgf activation but was dominant for one cellular phenotype and recessive for the other it impaired the nuclear accumulation of gaf but not of isgf in cells stimulated by interferons implying that the antimycobacterial but not the antiviral effects of human interferons are mediated by gaf more recently two patients have been identified with homozygous stat mutations who developed both post bcg vaccination disseminated disease and lethal viral infections the mutations in thes...
https://en.wikipedia.org/wiki/Germline_STAT_1_Mutation
*  World Families Forums - Tatum Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Tatum Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 11:10:54 PM. World Families Forums Family Boards Surname Projects Starting With 'T' Tatum Moderator: Ronnie Tatum Tatum Family Pedigrees previous next. Pages: 2. Author Topic: Tatum Family Pedigrees Read 14790 times. Ronnie Tatum Moderator Member Offline Posts: 9. Tatum Family Pedigrees on: February 13, 2005, 11:06:41 AM. We invite you to submit your "Pedigree ". for the. Tatum Family Project Patriarch. page. You don’t have to be a test participant to post your family pedigree. There are two ways to make your pedigree available to the project administrator for posting on the Patriarch Page: 1. Send the pedigree by email directly to. carrie@worldfamilies.net. in the simplified form described below. If you send it this way, your pedigree will only be posted on the Patriarch Page, and will not ...
http://worldfamilies.net/forum/index.php?topic=2893.msg110312
*  World Families Forums - Wilkes Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Wilkes Family Pedigrees. Welcome, Guest. Please login or register. October 07, 2015, 12:00:59 AM. World Families Forums Family Boards Surname Projects Starting With 'W' Wilkes Moderator: A Charles Wilkes Wilkes Family Pedigrees previous next. Pages:. Author Topic: Wilkes Family Pedigrees Read 7482 times. A Charles Wilkes Moderator New Member Offline Posts: 2. Wilkes Family Pedigrees on: January 06, 2005, 01:53:08 AM. We invite you to submit your "Pedigree ". for the. Wilkes Family Project Patriarch. page. You don’t have to be a test participant to post your family pedigree. There are two ways to make your pedigree available to the project administrator for posting on the Patriarch Page: 1. Send the pedigree by email directly to. carrie@worldfamilies.net. in the simplified form described below. If you send it this way, your pedigree will only be posted on the Patriarch Page,...
http://worldfamilies.net/forum/index.php?topic=2767.msg105944
*  World Families Forums - McAnally Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - McAnally Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 08:48:17 PM. World Families Forums Family Boards Surname Projects Starting With 'M' McAnally Moderator: mcanallyadmin McAnally Family Pedigrees previous next. Pages:. Author Topic: McAnally Family Pedigrees Read 1555 times. mcanallyadmin Moderator New Member Offline Posts: 3. McAnally Family Pedigrees on: January 24, 2006, 09:20:13 PM. We invite you to submit your "Pedigree ". for the. McAnally Family Project Patriarch. page. You don’t have to be a test participant to post your family pedigree. There are two ways to make your pedigree available to the project administrator for posting on the Patriarch Page: 1. Send the pedigree by email directly to. carrie@worldfamilies.net. in the simplified form described below. If you send it this way, your pedigree will only be posted on the Patriarch...
http://worldfamilies.net/forum/index.php?topic=3775.0
*  World Families Forums - Cromwell Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Cromwell Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 09:17:12 PM. World Families Forums Family Boards Surname Projects Starting With 'C' Cromwell Moderator: cromwellAdmin Cromwell Family Pedigrees previous next. Pages:. Author Topic: Cromwell Family Pedigrees Read 2914 times. cromwellAdmin Moderator New Member Offline Posts: 3. Cromwell Family Pedigrees on: January 25, 2006, 03:51:24 AM. We invite you to submit your "Pedigree ". for the. Cromwell Family Project Patriarch. page. You don’t have to be a test participant to post your family pedigree. There are two ways to make your pedigree available to the project administrator for posting on the Patriarch Page: 1. Send the pedigree by email directly to. carrie@worldfamilies.net. in the simplified form described below. If you send it this way, your pedigree will only be posted on the Patriarch...
http://worldfamilies.net/forum/index.php?topic=3882.msg147639
*  World Families Forums - Payton Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Payton Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 11:53:54 PM. World Families Forums Family Boards Surname Projects Starting With 'P' Payton Moderator: Richard M. Payton Payton Family Pedigrees previous next. Pages: 2. Author Topic: Payton Family Pedigrees Read 13849 times. Richard M. Payton Moderator Member Offline Posts: 15. Payton Family Pedigrees on: January 02, 2005, 08:44:17 PM. We invite you to submit your "Pedigree ". for the. Payton Family Project Patriarch. page. You don’t have to be a test participant to post your family pedigree. There are two ways to make your pedigree available to the project administrator for posting on the Patriarch Page: 1. Send the pedigree by email directly to. carrie@worldfamilies.net. in the simplified form described below. If you send it this way, your pedigree will only be posted on the Patriarch Pag...
http://worldfamilies.net/forum/index.php?topic=824.msg9187
*  Urban Dictionary: Aunt Marrhea
... Browse. A B C D E F G H I J K L M N O P Q R S T U V W X Y Z # new. Vote Favorites Store. Cart. English. Arabic. Azerbaijani. Bengali. Bulgarian. Chinese. Czech. Danish. Dutch. English. Filipino. French. German. Greek. Hebrew. Hungarian. Indonesian. Italian. Japanese. Korean. Norwegian. Polish. Portuguese. Romanian. Russian. Serbian. Spanish. Swedish. Thai. Turkish. Ukrainian. Vietnamese. Help translate. Top Definition. Aunt Marrhea. The eviler sister of 'Aunt Flow'. She who brings diarrhea with your lady cycle. Dude, not only did Aunt Flow stop by this morning, but she brought her sister, Aunt MaRrhea. by Mandalyn Knapic von Seldeneck September 18, 2008. 3 2. Add your own. Random Word. 6 Words related to Aunt Marrhea. aunt flow. blew ass. collywobbles. diarrhea. serious bm. splatter. Ten Words Trending Now. lemonparty. trap queen. on fleek. blumpkin. 1738. sapiosexual. fleek. sex. ratchet. alabama hot pocket. Alphabetical List. Aunt Jemima handshake. Aunt Jemimah'd. Aunt Jemima Mistake. Aunt ...
http://urbandictionary.com/define.php?term=Aunt Marrhea&defid=3349229
*  World Families Forums - Ring Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Ring Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 11:02:34 PM. World Families Forums Family Boards Surname Projects Starting With 'R' Ring Moderator: ringAdmin Ring Family Pedigrees previous next. Pages:. Author Topic: Ring Family Pedigrees Read 5532 times. ringAdmin Moderator New Member Offline Posts: 1. Ring Family Pedigrees on: June 23, 2006, 03:54:37 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Administrator. Please includ...
http://worldfamilies.net/forum/index.php?topic=5099.msg125018
*  World Families Forums - Michel Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Michel Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 04:51:36 PM. World Families Forums Family Boards Surname Projects Starting With 'M' Michel Moderator: Joyce Marschman Michel Family Pedigrees previous next. Pages: 2. Author Topic: Michel Family Pedigrees Read 9145 times. Joyce Marschman Moderator New Member Offline Posts: 3. Michel Family Pedigrees on: January 03, 2005, 12:09:16 AM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s A...
http://worldfamilies.net/forum/index.php?topic=1031.0
*  World Families Forums - Hahn Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Hahn Family Pedigrees. Welcome, Guest. Please login or register. October 07, 2015, 06:32:47 AM. World Families Forums Family Boards Surname Projects Starting With 'H' Hahn Moderator: Richard F. Hahn Hahn Family Pedigrees previous next. Pages:. Author Topic: Hahn Family Pedigrees Read 5557 times. Richard F. Hahn Moderator New Member Offline Posts: 2. Hahn Family Pedigrees on: January 03, 2005, 02:34:27 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Administrator...
http://worldfamilies.net/forum/index.php?topic=1741.msg9646
*  World Families Forums - Gould Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Gould Family Pedigrees. Welcome, Guest. Please login or register. October 07, 2015, 05:54:46 AM. World Families Forums Family Boards Surname Projects Starting With 'G' Gould Moderator: gouldAdmin Gould Family Pedigrees previous next. Pages:. Author Topic: Gould Family Pedigrees Read 9054 times. gouldAdmin Moderator New Member Offline Posts: 2. Gould Family Pedigrees on: January 03, 2005, 03:33:01 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Administrator. Ple...
http://worldfamilies.net/forum/index.php?topic=1810.msg12079
*  World Families Forums - Atwood Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Atwood Family Pedigrees. Welcome, Guest. Please login or register. October 07, 2015, 12:19:31 AM. World Families Forums Family Boards Surname Projects Starting With 'A' Atwood Moderator: atwoodAdmin Atwood Family Pedigrees previous next. Pages:. Author Topic: Atwood Family Pedigrees Read 12038 times. atwoodAdmin Moderator New Member Offline Posts: 2. Atwood Family Pedigrees on: January 04, 2005, 09:08:13 AM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Administra...
http://worldfamilies.net/forum/index.php?topic=2619.msg10727
*  World Families Forums - Stover Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Stover Family Pedigrees. Welcome, Guest. Please login or register. October 07, 2015, 06:39:14 AM. World Families Forums Family Boards Surname Projects Starting With 'S' Stover Moderator: StoverAdmin Stover Family Pedigrees previous next. Pages: 2. Author Topic: Stover Family Pedigrees Read 10509 times. StoverAdmin Moderator New Member Offline Posts: 3. Stover Family Pedigrees on: January 02, 2005, 01:09:22 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Administ...
http://worldfamilies.net/forum/index.php?topic=380.msg5818
*  World Families Forums - Sheehan Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Sheehan Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 08:58:14 PM. World Families Forums Family Boards Surname Projects Starting With 'S' Sheehan Moderator: Shirley B Fleming Sheehan Family Pedigrees previous next. Pages: 2. Author Topic: Sheehan Family Pedigrees Read 8779 times. Shirley B Fleming Moderator New Member Offline Posts: 4. Sheehan Family Pedigrees on: January 02, 2005, 04:44:30 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Pr...
http://worldfamilies.net/forum/index.php?topic=531.msg103025
*  World Families Forums - Santiago Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Santiago Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 11:04:46 PM. World Families Forums Family Boards Surname Projects Starting With 'S' Santiago Moderator: santiagoAdmin Santiago Family Pedigrees previous next. Pages:. Author Topic: Santiago Family Pedigrees Read 4383 times. santiagoAdmin Moderator New Member Offline Posts: 3. Santiago Family Pedigrees on: January 02, 2005, 05:20:08 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project...
http://worldfamilies.net/forum/index.php?topic=576.msg13694
*  World Families Forums - Samuels Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Samuels Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 12:38:37 PM. World Families Forums Family Boards Surname Projects Starting With 'S' Samuels Moderator: samuelsAdmin Samuels Family Pedigrees previous next. Pages:. Author Topic: Samuels Family Pedigrees Read 3433 times. samuelsAdmin Moderator New Member Offline Posts: 3. Samuels Family Pedigrees on: January 02, 2005, 05:29:38 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Admi...
http://worldfamilies.net/forum/index.php?topic=588.msg106267
*  World Families Forums - Tessier Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Tessier Family Pedigrees. Welcome, Guest. Please login or register. October 07, 2015, 06:49:06 AM. World Families Forums Family Boards Surname Projects Starting With 'T' Tessier Moderator: TessierAdmin Tessier Family Pedigrees previous next. Pages:. Author Topic: Tessier Family Pedigrees Read 1834 times. TessierAdmin Moderator New Member Offline Posts: 2. Tessier Family Pedigrees on: April 13, 2007, 04:50:25 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Admini...
http://worldfamilies.net/forum/index.php?topic=6536.new
*  World Families Forums - Hagger Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Hagger Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 11:22:33 PM. World Families Forums Family Boards Surname Projects Starting With 'H' Hagger Moderator: Peter Hagger Hagger Family Pedigrees previous next. Pages:. Author Topic: Hagger Family Pedigrees Read 1160 times. Peter Hagger Moderator New Member Offline Posts: 2. Hagger Family Pedigrees on: November 11, 2008, 11:15:00 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Administ...
http://worldfamilies.net/forum/index.php?topic=8225.0
*  World Families Forums - Patrick Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Patrick Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 12:23:23 PM. World Families Forums Family Boards Surname Projects Starting With 'P' Patrick Moderator: patrickAdmin Patrick Family Pedigrees previous next. Pages: 2 3. Author Topic: Patrick Family Pedigrees Read 19802 times. patrickAdmin Moderator New Member Offline Posts: 3. Patrick Family Pedigrees on: January 02, 2005, 08:51:23 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s...
http://worldfamilies.net/forum/index.php?topic=833.msg5061
*  World Families Forums - Ogden Family Pedigrees
... Home Forums. Surname Projects About DNA Testing FAQ Order Test Using FTDNA Help Site Map. Search this site:. World Families Forums - Ogden Family Pedigrees. Welcome, Guest. Please login or register. October 06, 2015, 12:54:37 PM. World Families Forums Family Boards Surname Projects Starting With 'O' Ogden Moderator: ogdenAdmin Ogden Family Pedigrees previous next. Pages:. Author Topic: Ogden Family Pedigrees Read 12637 times. ogdenAdmin Moderator New Member Offline Posts: 3. Ogden Family Pedigrees on: January 02, 2005, 10:25:24 PM. We invite you to submit your Pedigree for this Surname. Our Surname Project is primarily interested in your Paternal line, as surnames are passed down from father to son, just as the yDNA is passed down. If you ARE A MEMBER of this Surname Project at Family Tree DNA, send your pedigree by email to WorldFamilies.net at mari@worldfamilies.net. The pedigree will then be posted on the Surname Project s Patriarchs Page by Worldfamilies.net or sent to the Project’s Administrator. Pl...
http://worldfamilies.net/forum/index.php?topic=902.msg147469

Point mutationMissense mutation: In genetics, a missense mutation (a type of nonsynonymous substitution) is a point mutation in which a single nucleotide change results in a codon that codes for a different amino acid. Another type of nonsynonymous substitution is a nonsense mutation in which a codon is changed to a premature stop codon that results in truncation of the resulting protein.Silent mutation: Silent mutations are mutations in DNA that do not significantly alter the phenotype of the organism in which they occur. Silent mutations can occur in non-coding regions (outside of genes or within introns), or they may occur within exons.Frameshift mutation: A frameshift mutation (also called a framing error or a reading frame shift) is a genetic mutation caused by indels (insertions or deletions) of a number of nucleotides in a DNA sequence that is not divisible by three. Due to the triplet nature of gene expression by codons, the insertion or deletion can change the reading frame (the grouping of the codons), resulting in a completely different translation from the original.Germline STAT 1 Mutation: Interferons induce the formation of two transcriptional activators: gamma-activating factor (GAF) and interferon-stimulated gamma factor 3 (ISGF3). A natural heterozygous germline STAT1 mutation associated with susceptibility to mycobacterial but not viral disease was found in two unrelated patients with unexplained mycobacterial disease.Pedigree chart: A pedigree chart is a diagram that shows the occurrence and appearance or phenotypes of a particular gene or organism and its ancestors from one generation to the next,pedigree chart Genealogy Glossary - About.com, a part of The New York Times Company.Alternative splicing: Alternative splicing is a regulated process during gene expression that results in a single gene coding for multiple proteins. In this process, particular exons of a gene may be included within or excluded from the final, processed messenger RNA (mRNA) produced from that gene.Symmetry element: A symmetry element is a point of reference about which symmetry operations can take place. In particular, symmetry elements can be centers of inversion, axes of rotation and mirror planes.Thermal cyclerColes PhillipsInfinite alleles model: The infinite alleles model is a mathematical model for calculating genetic mutations. The Japanese geneticist Motoo Kimura and American geneticist James F.Single-strand conformation polymorphism: Single-strand conformation polymorphism (SSCP), or single-strand chain polymorphism, is defined as conformational difference of single-stranded nucleotide sequences of identical length as induced by differences in the sequences under certain experimental conditions. This property allows sequences to be distinguished by means of gel electrophoresis, which separates fragments according to their different conformations.Protein primary structure: The primary structure of a peptide or protein is the linear sequence of its amino acid structural units, and partly comprises its overall biomolecular structure. By convention, the primary structure of a protein is reported starting from the amino-terminal (N) end to the carboxyl-terminal (C) end.Nonsense mutation: In genetics, a nonsense mutation is a point mutation in a sequence of DNA that results in a premature stop codon, or a nonsense codon in the transcribed mRNA, and in a truncated, incomplete, and usually nonfunctional protein product. It differs from a missense mutation, which is a point mutation where a single nucleotide is changed to cause substitution of a different amino acid.DNA sequencer: A DNA sequencer is a scientific instrument used to automate the DNA sequencing process. Given a sample of DNA, a DNA sequencer is used to determine the order of the four bases: G (guanine), C (cytosine), A (adenine) and T (thymine).OpsismodysplasiaIridogoniodysgenesis, dominant type: Iridogoniodysgenesis, dominant type (type 1, IRID1) refers to a spectrum of diseases characterized by malformations of the irido-corneal angle of the anterior chamber of the eye. Iridogoniodysgenesis is the result of abnormal migration or terminal induction of neural crest cells.FERM domain: In molecular biology, the FERM domain (F for 4.1 protein, E for ezrin, R for radixin and M for moesin) is a widespread protein module involved in localising proteins to the plasma membrane.List of strains of Escherichia coli: Escherichia coli is a well studied bacterium that was first identified by Theodor Escherich, after whom it was later named.Suppressor mutation: A suppressor mutation is a second mutation that alleviates or reverts the phenotypic effects of an already existing mutation. Genetic suppression therefore restores the phenotype seen prior to the original background mutation.Phenotype microarray: The phenotype microarray approach is a technology for high-throughput phenotyping of cells.Reaction coordinateChromosome regionsCodon Adaptation Index: The Codon Adaptation Index (CAI) is the most widespread technique for analyzing Codon usage bias. As opposed to other measures of codon usage bias, such as the 'effective number of codons' (Nc), which measure deviation from a uniform bias (null hypothesis), CAI measures the deviation of a given protein coding gene sequence with respect to a reference set of genes.DNA binding site: DNA binding sites are a type of binding site found in DNA where other molecules may bind. DNA binding sites are distinct from other binding sites in that (1) they are part of a DNA sequence (e.DNA-binding proteinDeletion (genetics)Pituitary-specific positive transcription factor 1: POU domain, class 1, transcription factor 1 (Pit1, growth hormone factor 1), also known as POU1F1, is a transcription factor for growth hormone.Malformative syndrome: A malformative syndrome (or malformation syndrome) is a recognizable pattern of congenital anomalies that are known or thought to be causally related (VIIth International Congress on Human Genetics).Ligation-independent cloning: Ligation-independent cloning (LIC) is a form of molecular cloning that is able to be performed without the use of restriction endonucleases or DNA ligase. This allows genes that have restriction sites to be cloned without worry of chopping up the insert.Proximity ligation assay: Proximity ligation assay (in situ PLA) is a technology that extends the capabilities of traditional immunoassays to include direct detection of proteins, protein interactions and modifications with high specificity and sensitivity. Protein targets can be readily detected and localized with single molecule resolution and objectively quantified in unmodified cells and tissues.CS-BLASTDNA condensation: DNA condensation refers to the process of compacting DNA molecules in vitro or in vivo. Mechanistic details of DNA packing are essential for its functioning in the process of gene regulation in living systems.Genetic linkage: Genetic linkage is the tendency of alleles that are located close together on a chromosome to be inherited together during the meiosis phase of sexual reproduction. Genes whose loci are nearer to each other are less likely to be separated onto different chromatids during chromosomal crossover, and are therefore said to be genetically linked.Zuotin: Z-DNA binding protein 1, also known as Zuotin, is a Saccharomyces cerevisiae yeast gene.Membrane protein: Membrane proteins are proteins that interact with biological membranes. They are one of the common types of protein along with soluble globular proteins, fibrous proteins, and disordered proteins.Cousin couple: A cousin couple is a pair of cousins who are involved in a romantic or sexual relationship.Ferric uptake regulator family: In molecular biology, the ferric uptake regulator (FUR) family of proteins includes metal ion uptake regulator proteins. These are responsible for controlling the intracellular concentration of iron in many bacteria.Triparental mating: Triparental mating is a form of Bacterial conjugation where a conjugative plasmid present in one bacterial strain assists the transfer of a mobilizable plasmid present in a second bacterial strain into a third bacterial strain. Plasmids are introduced into bacteria for such purposes as transformation, cloning, or transposon mutagenesis.RNA transfection: RNA transfection is the process of deliberately introducing RNA into a living cell. RNA can be purified from cells after lysis or synthesized from free nucleotides either chemically, or enzymatically using an RNA polymerase to transcribe a DNA template.Exome: The exome is the part of the genome formed by exons, the sequences which when transcribed remain within the mature RNA after introns are removed by RNA splicing. It consists of all DNA that is transcribed into mature RNA in cells of any type as distinct from the transcriptome, which is the RNA that has been transcribed only in a specific cell population.Gene polymorphismHaplogroup L0 (mtDNA)VemurafenibSignature-tagged mutagenesis: Signature-tagged mutagenesis (STM) is a genetic technique used to study gene function. Recent advances in genome sequencing have allowed us to catalogue a large variety of organisms' genomes, but the function of the genes they contain is still largely unknown.Eukaryotic transcription: Eukaryotic transcription is the elaborate process that eukaryotic cells use to copy genetic information stored in DNA into units of RNA replica. Gene transcription occurs in both eukaryotic and prokaryotic cells.GC box: In molecular biology, a GC box is a distinct pattern of nucleotides found in the promoter region of some eukaryotic genes upstream of the TATA box and approximately 110 bases upstream from the transcription initiation site. It has a consensus sequence GGGCGG which is position dependent and orientation independent.Genetic variation: right|thumbIntron: right|thumbnail|270px|Representation of intron and [[exons within a simple gene containing a single intron.]]Database of protein conformational diversity: The Database of protein conformational diversity (PCDB) is a database of diversity of protein tertiary structures within protein domains as determined by X-ray crystallography. Proteins are inherently flexible and this database collects information on this subject for use in molecular research.Mature messenger RNA: Mature messenger RNA, often abbreviated as mature mRNA is a eukaryotic RNA transcript that has been spliced and processed and is ready for translation in the course of protein synthesis. Unlike the eukaryotic RNA immediately after transcription known as precursor messenger RNA, it consists exclusively of exons, with all introns removed.Recombination (cosmology): In cosmology, recombination refers to the epoch at which charged electrons and protons first became bound to form electrically neutral hydrogen atoms.Note that the term recombination is a misnomer, considering that it represents the first time that electrically neutral hydrogen formed.Microsatellite: A microsatellite is a tract of repetitive DNA in which certain DNA motifs (ranging in length from 2–5 base pairs) are repeated, typically 5-50 times. Microsatellites occur at thousands of locations in the human genome and they are notable for their high mutation rate and high diversity in the population.Ethyl groupResistance mutation: A resistance mutation is a point mutations in virus genes that allow the virus to become resistant to treatment with a particular antiviral drug. The term was first used in the management of HIV, the first virus in which genome sequencing was routinely used to look for drug resistance.Jewish Community Council of Victoria: The Jewish Community Council of Victoria Inc (JCCV) is the peak representative body for Victorian Jewry, representing nearly 60 Jewish community organisations and over 52,000 Victorian Jews. The JCCV’s mission is to represent the Victorian Jewish community, the largest Jewish community in Australia, on all matters that affect its status, welfare and interests.Burst kinetics: Burst kinetics is a form of enzyme kinetics that refers to an initial high velocity of enzymatic turnover when adding enzyme to substrate. This initial period of high velocity product formation is referred to as the "Burst Phase".Mutagen: In genetics, a mutagen is a physical or chemical agent that changes the genetic material, usually DNA, of an organism and thus increases the frequency of mutations above the natural background level. As many mutations can cause cancer, mutagens are therefore also likely to be carcinogens.Amplified fragment length polymorphism

(1/138264) Modified peptidoglycan transpeptidase activity in a carbenicillin-resistant mutant of Pseudomonas aeruginosa 18s.

A carbenicillin-resistant mutant of Pseudomonas aeruginosa 18s was found to possess peptidoglycan transpeptidase activity significantly more resistant to inhibition by benzyl penicillin, ampicillin, carbenicillin, and cephaloridine than that of the parent strain. The mutant was more resistant than the parent strain to all of the beta-lactam antibiotics tested, and 50% inhibition values for these compounds against membrane-bound model transpeptidase activity paralleled this increase. The resistance of the mutant to kanamycin, streptomycin, and chloramphenicol was unchanged.  (+info)

(2/138264) Marker effects on reversion of T4rII mutants.

The frequencies of 2-aminopurine- and 5-bromouracil-induced A:T leads to G:C transitions were compared at nonsense sites throughout the rII region of bacteriophage T4. These frequencies are influenced both by adjacent base pairs within the nonsense codons and by extracodonic factors. Following 2AP treatment, they are high in amber (UAG) and lower in opal (UGA) codons than in allelic ochre (UAA) codons. In general, 5BU-induced transitions are more frequent in both amber and opal codons than in the allelic ochre codons. 2AP- and 5BU-induced transition frequencies in the first and third positions of opal codons are correlated with those in the corresponding positions of the allelic ochre codons. Similarly, the frequencies of 2AP-induced transition in the first and second positions of amber codons and their ochre alleles are correlated. However, there is little correlation between the frequencies of 5BU-induced transitions in the first and second positions of allelic amber and ochre codons.  (+info)

(3/138264) Nonbehavioral selection for pawns, mutants of Paramecium aurelia with decreased excitability.

The reversal response in Paramecium aurelia is mediated by calcium which carries the inward current during excitation. Electrophysiological studies indicate that strontium and barium can also carry the inward current. Exposure to high concentrations of barium rapidly paralyzes and later kills wild-type paramecia. Following mutagenesis with nitrosoguanidine, seven mutants which continued to swim in the ;high-barium' solution were selected. All of the mutants show decreased reversal behavior, with phenotypes ranging from extremely non-reversing (;extreme' pawns) to nearly wild-type reversal behavior (;partial' pawns). The mutations fall into three complementation groups, identical to the pwA, pwB, and pwC genes of Kunget al. (1975). All of the pwA and pwB mutants withstand longer exposure to barium, the pwB mutants surviving longer than the pwA mutants. Among mutants of each gene, survival is correlated with loss of reversal behavior. Double mutants (A-B, A-C, B-C), identified in the exautogamous progeny of crosses between ;partial' mutants, exhibited a more extreme non-reversing phenotype than either of their single-mutant (;partial' pawn) parents.---Inability to reverse could be expected from an alteration in the calcium-activated reversal mechanism or in excitation. A normal calcium-activated structure was demonstrated in all pawns by chlorpromazine treatment. In a separate report (Schein, Bennett and Katz 1976) the results of electrophysiological investigations directly demonstrate decreased excitability in all of the mutants, a decrease due to an altered calcium activation. The studies of the genetics, the survival in barium and the electro-physiology of the pawns demonstrate that the pwA and pwB genes have different effects on calcium activation.  (+info)

(4/138264) Testing for selective neutrality of electrophoretically detectable protein polymorphisms.

The statistical assessment of gene-frequency data on protein polymorphisms in natural populations remains a contentious issue. Here we formulate a test of whether polymorphisms detected by electrophoresis are in accordance with the stepwise, or charge-state, model of mutation in finite populations in the absence of selection. First, estimates of the model parameters are derived by minimizing chi-square deviations of the observed frequencies of genotypes with alleles (0,1,2...) units apart from their theoretical expected values. Then the remaining deviation is tested under the null hypothesis of neutrality. The procedure was found to be conservative for false rejections in simulation data. We applied the test to Ayala and Tracey 's data on 27 allozymic loci in six populations of Drosophila willistoni . About one-quarter of polymorphic loci showed significant departure from the neutral theory predictions in virtually all populations. A further quarter showed significant departure in some populations. The remaining data showed an acceptable fit to the charge state model. A predominating mode of selection was selection against alleles associated with extreme electrophoretic mobilities. The advantageous properties and the difficulties of the procedure are discussed.  (+info)

(5/138264) Apontic binds the translational repressor Bruno and is implicated in regulation of oskar mRNA translation.

The product of the oskar gene directs posterior patterning in the Drosophila oocyte, where it must be deployed specifically at the posterior pole. Proper expression relies on the coordinated localization and translational control of the oskar mRNA. Translational repression prior to localization of the transcript is mediated, in part, by the Bruno protein, which binds to discrete sites in the 3' untranslated region of the oskar mRNA. To begin to understand how Bruno acts in translational repression, we performed a yeast two-hybrid screen to identify Bruno-interacting proteins. One interactor, described here, is the product of the apontic gene. Coimmunoprecipitation experiments lend biochemical support to the idea that Bruno and Apontic proteins physically interact in Drosophila. Genetic experiments using mutants defective in apontic and bruno reveal a functional interaction between these genes. Given this interaction, Apontic is likely to act together with Bruno in translational repression of oskar mRNA. Interestingly, Apontic, like Bruno, is an RNA-binding protein and specifically binds certain regions of the oskar mRNA 3' untranslated region.  (+info)

(6/138264) oko meduzy mutations affect neuronal patterning in the zebrafish retina and reveal cell-cell interactions of the retinal neuroepithelial sheet.

Mutations of the oko meduzy (ome) locus cause drastic neuronal patterning defect in the zebrafish retina. The precise, stratified appearance of the wild-type retina is absent in the mutants. Despite the lack of lamination, at least seven retinal cell types differentiate in oko meduzy. The ome phenotype is already expressed in the retinal neuroepithelium affecting morphology of the neuroepithelial cells. Our experiments indicate that previously unknown cell-cell interactions are involved in development of the retinal neuroepithelial sheet. In genetically mosaic animals, cell-cell interactions are sufficient to rescue the phenotype of oko meduzy retinal neuroepithelial cells. These cell-cell interactions may play a critical role in the patterning events that lead to differentiation of distinct neuronal laminae in the vertebrate retina.  (+info)

(7/138264) Cancer genetics: tumor suppressor meets oncogene.

The adenomatous polyposis coli (APC) tumor suppressor protein is inactivated by mutations in the majority of colorectal cancers. A recent study has revealed that alterations in the APC signaling pathway can result in the transcriptional activation of the c-MYC gene.  (+info)

(8/138264) Alzheimer's disease: clues from flies and worms.

Presenilin mutations give rise to familial Alzheimer's disease and result in elevated production of amyloid beta peptide. Recent evidence that presenilins act in developmental signalling pathways may be the key to understanding how senile plaques, neurofibrillary tangles and apoptosis are all biochemically linked.  (+info)


mutation.............?


3' T A C   A C G  C A A  A T G   C C C   A G A   G C T  A T C  5'
5' A U G   U G C  G U U  U A C  G G G   U C U  C G A  U A G  3'        
Met      Cys       Val     Tyr       Gly       Ser       Arg    Stop            

Why might this be serious?
----------

because the nucleic acids are for one not lined up correctly. They should be lined up adenine-thymine, guanine-cytosine. There is also an extra acid that should be matched up with the other strain because the deoxyribonucleic acid bonding must consist of equal pairing due to the double helix structure.


What is the difference between a gene mutation and a chromosomal mutation?


Is a neural tube deffect a chromosomal mutation or a gene mutation?  What is the difference between the two types of mutations?
----------

A gene mutation is a permanent change in the DNA sequence that makes up a gene. Mutations range in size from a single DNA building block (DNA base) to a large segment of a chromosome.

A chromosomal mutation is a mutation  involving a long segment of DNA, it is a any change in the structure or arrangement of the chromosomes. These mutations can involve deletions, insertions, or inversions of sections of DNA. In some cases, deleted sections may attach to other chromosomes, disrupting both the chromosomes that loses the DNA and the one that gains it.It is  also referred to as a chromosomal rearrangement


Neural tube defects (NTDs) are common birth defects of the brain and spinal cord that include anencephaly and spina bifida (meningomyelocele). Deficiency of the vitamin folic acid raises the risk of NTDs, as does mutation of a gene for an enzyme that processes folic acid. The mutation is called the C677T.People with two copies of the T mutation are two and a half times as likely to have a NTD as people with two copies of the normal gene. Now it has been found that people with just one copy of the T gene are also at increased risk for an NTD. They are one and a half times more likely to have a NTD than people with two copies of the normal gene.

There is evidence that some mothers of infants with Down's syndrome have abnormal metabolism of folate and methyl, as well as mutations in folate genes, which are features that are also seen in neural-tube defects (NTD).


What is the mutation that causes bipolar disorder and what type is it?


If it's a gene mutation, what type is it, and if it's a chromosome mutation, which type is it?
Thanks in advance for all your answers.
----------

Psychiatry and psychology cannot even prove the cause of depression or anything else, it is all 
 'educated'  subjective observation of patterns in people.........
They cannot identify with any certainty what is and isnt genetic with any certainty.........they make their best guesses.......
BiPolar , to hormone experts, MAY be undiagnosed hormone imbalances, and I just read that a person healed by seeing a hormone expert and having her thyroid fine tuned.........the bi polar remitted or healed........
Some will make bold claims  of a genetic component, but there is no real proof.


What is the type of mutation responsible for Down Syndrome and what for Turner syndrome?


What is the type of mutation responsible for Down Syndrome and what for Turner syndrome?
----------

Neither of these conditions is caused by a mutation - a mutation is a change in the base pair sequence of a gene.  Down Syndrome is caused by an extra chromosome and Turner Syndrome is caused by a missing or damaged X chromosome.


Does my child have to inherit the same mutation from both parents in order to develop cystic fibrosis?


My wife and I both carry a defective CF gene. We each carry a different mutation. We found out after she got pregnant. The doctor just called and said that out baby tested positive for CF. This means that she can only be a carrier or possible have CF. Does she have to have two copies of the SAME mutation to develop CF, or will she just be a carrier?
----------

No.  There are over 1,000 different CF mutations, which can be the combination of two different CF mutations.  I'm sorry but it sounds like your daughter has CF.  If she was a CF carrier your doctor would have told you that.

My seven year old daughter has CF.  If I can help in any way please feel free to contact me.  Please do not use the Internet to research CF unless it is www.cff.org.  The stories posted by people are not necessarily the norm.  Each person with CF is different.  Even if they have the same type of mutation.  Find a CF doctor that you like and feel comfortable talking to you.  We've found that most doctors don't know a whole lot about CF and it is important for you to talk to someone that can give you real answers and guidance.


Is there a gene or mutation that causes someone to be an alcoholic?


My father was a drunk. My mom split with him after having me, and she found the guy who is now my dad. Anyways, All the males in his family were drunks. My mom says that I should be careful If and When I start to drink alcohol because I might not be able to stop myself because me father and all the males in his family are drunks, even though I dont know him and dont even remember ever having met him.
So my queestion is,(obviously) is there a gene or genetic mutation that may cause or lead to being an alcoholic?
----------

I don't think there's a definite answer. But I believe I've seen studies that show that you have a higher chance of being an alcoholic if you have family members who are. It might be an environmental factor of being exposed to them so you may not need to worry. Alcoholism runs in my family but I have not had a problem probably because I do not spend time with them. :)


What is an example of a mutation in the tumor suppressor pathway that is involved in the production of cancer?


I have science homework and im very confused. here is the instructions - try to find one good example of how a mutation in a gene that regulates the cell cycle (either in the growth factor pathway, or the tumor suppressor pathway) is involved in the development of cancer.
----------

40% of all Retinoblastoma cases are caused by a mutation on chromsome 11 containing the tumor suppressor gene Retinoblastoma protein( Rb1).

Another example is with pancreatic cancer. The deletion of the Trp53 tumor suppressor protein can cause malignant neoplasms to form within the G1 phase of the cell cycle. Sometimes Adenoviruses like SV40 can cause P53 deletion through the use of an enzyme to implant it's DNA in host cells.


What is the sequence of the mutation for the gene that causes albinism?


The main enzyme for making melanin is Tyrosinase, but I don't know the actual location of the gene or its mutation, besides it occurs on chromosome 11.
----------

Okay but which subtype?? 

oculocutaneous albinism 1 is the one that comes to mind due to your stating about the 11th chromosome and the absence of tyrosinase. The mutations happen by inactivity of the tyrosinase or in the production ...so there is a nullity in the mutation or there is the leaky mutation.  That is 11q14-21

Now, if your talking about the subtype OCA1A, that's a whole 'nother ball of wax and it's simply nonsense sequential mutations. 11q24.

If I haven't answered your question, give me a personal buzz and I'll work you through it @taylordesigns2003@yahoo.com