Helicobacter pylori: A spiral bacterium active as a human gastric pathogen. It is a gram-negative, urease-positive, curved or slightly spiral organism initially isolated in 1982 from patients with lesions of gastritis or peptic ulcers in Western Australia. Helicobacter pylori was originally classified in the genus CAMPYLOBACTER, but RNA sequencing, cellular fatty acid profiles, growth patterns, and other taxonomic characteristics indicate that the micro-organism should be included in the genus HELICOBACTER. It has been officially transferred to Helicobacter gen. nov. (see Int J Syst Bacteriol 1989 Oct;39(4):297-405).Helicobacter Infections: Infections with organisms of the genus HELICOBACTER, particularly, in humans, HELICOBACTER PYLORI. The clinical manifestations are focused in the stomach, usually the gastric mucosa and antrum, and the upper duodenum. This infection plays a major role in the pathogenesis of type B gastritis and peptic ulcer disease.Helicobacter: A genus of gram-negative, spiral-shaped bacteria that has been isolated from the intestinal tract of mammals, including humans. It has been associated with PEPTIC ULCER.Gastritis: Inflammation of the GASTRIC MUCOSA, a lesion observed in a number of unrelated disorders.Gastric Mucosa: Lining of the STOMACH, consisting of an inner EPITHELIUM, a middle LAMINA PROPRIA, and an outer MUSCULARIS MUCOSAE. The surface cells produce MUCUS that protects the stomach from attack by digestive acid and enzymes. When the epithelium invaginates into the LAMINA PROPRIA at various region of the stomach (CARDIA; GASTRIC FUNDUS; and PYLORUS), different tubular gastric glands are formed. These glands consist of cells that secrete mucus, enzymes, HYDROCHLORIC ACID, or hormones.Urease: An enzyme that catalyzes the conversion of urea and water to carbon dioxide and ammonia. EC 3.5.1.5.Peptic Ulcer: Ulcer that occurs in the regions of the GASTROINTESTINAL TRACT which come into contact with GASTRIC JUICE containing PEPSIN and GASTRIC ACID. It occurs when there are defects in the MUCOSA barrier. The common forms of peptic ulcers are associated with HELICOBACTER PYLORI and the consumption of nonsteroidal anti-inflammatory drugs (NSAIDS).Clarithromycin: A semisynthetic macrolide antibiotic derived from ERYTHROMYCIN that is active against a variety of microorganisms. It can inhibit PROTEIN SYNTHESIS in BACTERIA by reversibly binding to the 50S ribosomal subunits. This inhibits the translocation of aminoacyl transfer-RNA and prevents peptide chain elongation.Metronidazole: A nitroimidazole used to treat AMEBIASIS; VAGINITIS; TRICHOMONAS INFECTIONS; GIARDIASIS; ANAEROBIC BACTERIA; and TREPONEMAL INFECTIONS. It has also been proposed as a radiation sensitizer for hypoxic cells. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985, p133), this substance may reasonably be anticipated to be a carcinogen (Merck, 11th ed).Stomach: An organ of digestion situated in the left upper quadrant of the abdomen between the termination of the ESOPHAGUS and the beginning of the DUODENUM.Amoxicillin: A broad-spectrum semisynthetic antibiotic similar to AMPICILLIN except that its resistance to gastric acid permits higher serum levels with oral administration.Dyspepsia: Impaired digestion, especially after eating.Anti-Ulcer Agents: Various agents with different action mechanisms used to treat or ameliorate PEPTIC ULCER or irritation of the gastrointestinal tract. This has included ANTIBIOTICS to treat HELICOBACTER INFECTIONS; HISTAMINE H2 ANTAGONISTS to reduce GASTRIC ACID secretion; and ANTACIDS for symptomatic relief.Omeprazole: A 4-methoxy-3,5-dimethylpyridyl, 5-methoxybenzimidazole derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits an H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.Bacterial Proteins: Proteins found in any species of bacterium.Stomach Neoplasms: Tumors or cancer of the STOMACH.Stomach Diseases: Pathological processes involving the STOMACH.Gastritis, Atrophic: GASTRITIS with atrophy of the GASTRIC MUCOSA, the GASTRIC PARIETAL CELLS, and the mucosal glands leading to ACHLORHYDRIA. Atrophic gastritis usually progresses from chronic gastritis.Bismuth: A metallic element that has the atomic symbol Bi, atomic number 83 and atomic weight 208.98.Pyloric Antrum: The region between the sharp indentation at the lower third of the STOMACH (incisura angularis) and the junction of the PYLORUS with the DUODENUM. Pyloric antral glands contain mucus-secreting cells and gastrin-secreting endocrine cells (G CELLS).Antigens, Bacterial: Substances elaborated by bacteria that have antigenic activity.Duodenal Ulcer: A PEPTIC ULCER located in the DUODENUM.Breath Tests: Any tests done on exhaled air.Stomach Ulcer: Ulceration of the GASTRIC MUCOSA due to contact with GASTRIC JUICE. It is often associated with HELICOBACTER PYLORI infection or consumption of nonsteroidal anti-inflammatory drugs (NSAIDS).Anti-Bacterial Agents: Substances that reduce the growth or reproduction of BACTERIA.Helicobacter hepaticus: A species of HELICOBACTER that colonizes the CECUM and COLON of several strains of MICE, and is associated with HEPATITIS and carcinogenesis.Gastroscopy: Endoscopic examination, therapy or surgery of the interior of the stomach.Antibodies, Bacterial: Immunoglobulins produced in a response to BACTERIAL ANTIGENS.Helicobacter heilmannii: A species of gram-negative, spiral-shaped bacteria found in the gastric mucosa that is associated with chronic antral gastritis. This bacterium was first discovered in samples removed at endoscopy from patients investigated for HELICOBACTER PYLORI colonization.Lansoprazole: A 2,2,2-trifluoroethoxypyridyl derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS. Lansoprazole is a racemic mixture of (R)- and (S)-isomers.2-Pyridinylmethylsulfinylbenzimidazoles: Compounds that contain benzimidazole joined to a 2-methylpyridine via a sulfoxide linkage. Several of the compounds in this class are ANTI-ULCER AGENTS that act by inhibiting the POTASSIUM HYDROGEN ATPASE found in the PROTON PUMP of GASTRIC PARIETAL CELLS.Proton Pump Inhibitors: Compounds that inhibit H(+)-K(+)-EXCHANGING ATPASE. They are used as ANTI-ULCER AGENTS and sometimes in place of HISTAMINE H2 ANTAGONISTS for GASTROESOPHAGEAL REFLUX.Drug Therapy, Combination: Therapy with two or more separate preparations given for a combined effect.Tinidazole: A nitroimidazole antitrichomonal agent effective against Trichomonas vaginalis, Entamoeba histolytica, and Giardia lamblia infections.Lewis Blood-Group System: A group of dominantly and independently inherited antigens associated with the ABO blood factors. They are glycolipids present in plasma and secretions that may adhere to the erythrocytes. The phenotype Le(b) is the result of the interaction of the Le gene Le(a) with the genes for the ABO blood groups.Metaplasia: A condition in which there is a change of one adult cell type to another similar adult cell type.Pepsinogen A: This is one of 2 related pepsinogen systems in humans and is also known as pepsinogen. (The other is PEPSINOGEN C.) This includes isozymogens Pg1-Pg5 (pepsinogens 1-5, group I or products of PGA1-PGA5 genes). This is the main pepsinogen found in urine.Biopsy: Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body.Ranitidine: A non-imidazole blocker of those histamine receptors that mediate gastric secretion (H2 receptors). It is used to treat gastrointestinal ulcers.Urea: A compound formed in the liver from ammonia produced by the deamination of amino acids. It is the principal end product of protein catabolism and constitutes about one half of the total urinary solids.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Endoscopy, Gastrointestinal: Endoscopic examination, therapy or surgery of the gastrointestinal tract.Duodenitis: Inflammation of the DUODENUM section of the small intestine (INTESTINE, SMALL). Erosive duodenitis may cause bleeding in the UPPER GI TRACT and PEPTIC ULCER.Furazolidone: A nitrofuran derivative with antiprotozoal and antibacterial activity. Furazolidone acts by gradual inhibition of monoamine oxidase. (From Martindale, The Extra Pharmacopoeia, 30th ed, p514)Gerbillinae: A subfamily of the Muridae consisting of several genera including Gerbillus, Rhombomys, Tatera, Meriones, and Psammomys.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Cytotoxins: Substances that are toxic to cells; they may be involved in immunity or may be contained in venoms. These are distinguished from CYTOSTATIC AGENTS in degree of effect. Some of them are used as CYTOTOXIC ANTIBIOTICS. The mechanism of action of many of these are as ALKYLATING AGENTS or MITOSIS MODULATORS.Gastrins: A family of gastrointestinal peptide hormones that excite the secretion of GASTRIC JUICE. They may also occur in the central nervous system where they are presumed to be neurotransmitters.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Gastric Acid: Hydrochloric acid present in GASTRIC JUICE.Lymphoma, B-Cell, Marginal Zone: Extranodal lymphoma of lymphoid tissue associated with mucosa that is in contact with exogenous antigens. Many of the sites of these lymphomas, such as the stomach, salivary gland, and thyroid, are normally devoid of lymphoid tissue. They acquire mucosa-associated lymphoid tissue (MALT) type as a result of an immunologically mediated disorder.Pepsinogens: Proenzymes secreted by chief cells, mucous neck cells, and pyloric gland cells, which are converted into pepsin in the presence of gastric acid or pepsin itself. (Dorland, 28th ed) In humans there are 2 related pepsinogen systems: PEPSINOGEN A (formerly pepsinogen I or pepsinogen) and PEPSINOGEN C (formerly pepsinogen II or progastricsin). Pepsinogen B is the name of a pepsinogen from pigs.Antacids: Substances that counteract or neutralize acidity of the GASTROINTESTINAL TRACT.Tetracycline: A naphthacene antibiotic that inhibits AMINO ACYL TRNA binding during protein synthesis.Pepsinogen C: This is one of the 2 related pepsinogen systems in humans. It is found in prostate and seminal fluid whereas PEPSINOGEN A is not.Antitrichomonal Agents: Agents used to treat trichomonas infections.Nitroreductases: Enzymes which reduce nitro groups (NITRO COMPOUNDS) and other nitrogenous compounds.Penicillins: A group of antibiotics that contain 6-aminopenicillanic acid with a side chain attached to the 6-amino group. The penicillin nucleus is the chief structural requirement for biological activity. The side-chain structure determines many of the antibacterial and pharmacological characteristics. (Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th ed, p1065)Rabeprazole: A 4-(3-methoxypropoxy)-3-methylpyridinyl derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.Pylorus: The region of the STOMACH at the junction with the DUODENUM. It is marked by the thickening of circular muscle layers forming the pyloric sphincter to control the opening and closure of the lumen.Immunoglobulin G: The major immunoglobulin isotype class in normal human serum. There are several isotype subclasses of IgG, for example, IgG1, IgG2A, and IgG2B.Genes, Bacterial: The functional hereditary units of BACTERIA.Virulence: The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.Bacterial Adhesion: Physicochemical property of fimbriated (FIMBRIAE, BACTERIAL) and non-fimbriated bacteria of attaching to cells, tissue, and nonbiological surfaces. It is a factor in bacterial colonization and pathogenicity.Virulence Factors: Those components of an organism that determine its capacity to cause disease but are not required for its viability per se. Two classes have been characterized: TOXINS, BIOLOGICAL and surface adhesion molecules that effect the ability of the microorganism to invade and colonize a host. (From Davis et al., Microbiology, 4th ed. p486)Gastric Mucins: Mucins that are found on the surface of the gastric epithelium. They play a role in protecting the epithelial layer from mechanical and chemical damage.Gastric Juice: The liquid secretion of the stomach mucosa consisting of hydrochloric acid (GASTRIC ACID); PEPSINOGENS; INTRINSIC FACTOR; GASTRIN; MUCUS; and the bicarbonate ion (BICARBONATES). (From Best & Taylor's Physiological Basis of Medical Practice, 12th ed, p651)Organometallic Compounds: A class of compounds of the type R-M, where a C atom is joined directly to any other element except H, C, N, O, F, Cl, Br, I, or At. (Grant & Hackh's Chemical Dictionary, 5th ed)Sulfoxides: Organic compounds that have the general formula R-SO-R. They are obtained by oxidation of mercaptans (analogous to the ketones). (From Hackh's Chemical Dictionary, 4th ed)Endoscopy, Digestive System: Endoscopic examination, therapy or surgery of the digestive tract.Gastrointestinal Diseases: Diseases in any segment of the GASTROINTESTINAL TRACT from ESOPHAGUS to RECTUM.Enzyme-Linked Immunosorbent Assay: An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed.Antigens, CD15: A trisaccharide antigen expressed on glycolipids and many cell-surface glycoproteins. In the blood the antigen is found on the surface of NEUTROPHILS; EOSINOPHILS; and MONOCYTES. In addition, CD15 antigen is a stage-specific embryonic antigen.Seroepidemiologic Studies: EPIDEMIOLOGIC STUDIES based on the detection through serological testing of characteristic change in the serum level of specific ANTIBODIES. Latent subclinical infections and carrier states can thus be detected in addition to clinically overt cases.Achlorhydria: A lack of HYDROCHLORIC ACID in GASTRIC JUICE despite stimulation of gastric secretion.Parietal Cells, Gastric: Rounded or pyramidal cells of the GASTRIC GLANDS. They secrete HYDROCHLORIC ACID and produce gastric intrinsic factor, a glycoprotein that binds VITAMIN B12.Adhesins, Bacterial: Cell-surface components or appendages of bacteria that facilitate adhesion (BACTERIAL ADHESION) to other cells or to inanimate surfaces. Most fimbriae (FIMBRIAE, BACTERIAL) of gram-negative bacteria function as adhesins, but in many cases it is a minor subunit protein at the tip of the fimbriae that is the actual adhesin. In gram-positive bacteria, a protein or polysaccharide surface layer serves as the specific adhesin. What is sometimes called polymeric adhesin (BIOFILMS) is distinct from protein adhesin.Prevalence: The total number of cases of a given disease in a specified population at a designated time. It is differentiated from INCIDENCE, which refers to the number of new cases in the population at a given time.Gastroesophageal Reflux: Retrograde flow of gastric juice (GASTRIC ACID) and/or duodenal contents (BILE ACIDS; PANCREATIC JUICE) into the distal ESOPHAGUS, commonly due to incompetence of the LOWER ESOPHAGEAL SPHINCTER.Sensitivity and Specificity: Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)Microbial Sensitivity Tests: Any tests that demonstrate the relative efficacy of different chemotherapeutic agents against specific microorganisms (i.e., bacteria, fungi, viruses).Genomic Islands: Distinct units in some bacterial, bacteriophage or plasmid GENOMES that are types of MOBILE GENETIC ELEMENTS. Encoded in them are a variety of fitness conferring genes, such as VIRULENCE FACTORS (in "pathogenicity islands or islets"), ANTIBIOTIC RESISTANCE genes, or genes required for SYMBIOSIS (in "symbiosis islands or islets"). They range in size from 10 - 500 kilobases, and their GC CONTENT and CODON usage differ from the rest of the genome. They typically contain an INTEGRASE gene, although in some cases this gene has been deleted resulting in "anchored genomic islands".Peptic Ulcer Hemorrhage: Bleeding from a PEPTIC ULCER that can be located in any segment of the GASTROINTESTINAL TRACT.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Epithelial Cells: Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.Interleukin-8: A member of the CXC chemokine family that plays a role in the regulation of the acute inflammatory response. It is secreted by variety of cell types and induces CHEMOTAXIS of NEUTROPHILS and other inflammatory cells.Drug Resistance, Bacterial: The ability of bacteria to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).RNA, Ribosomal, 23S: Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.Azure Stains: PHENOTHIAZINES with an amino group at the 3-position that are green crystals or powder. They are used as biological stains.Genome, Bacterial: The genetic complement of a BACTERIA as represented in its DNA.Feces: Excrement from the INTESTINES, containing unabsorbed solids, waste products, secretions, and BACTERIA of the DIGESTIVE SYSTEM.Campylobacter: A genus of bacteria found in the reproductive organs, intestinal tract, and oral cavity of animals and man. Some species are pathogenic.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Endoscopy: Procedures of applying ENDOSCOPES for disease diagnosis and treatment. Endoscopy involves passing an optical instrument through a small incision in the skin i.e., percutaneous; or through a natural orifice and along natural body pathways such as the digestive tract; and/or through an incision in the wall of a tubular structure or organ, i.e. transluminal, to examine or perform surgery on the interior parts of the body.Colony Count, Microbial: Enumeration by direct count of viable, isolated bacterial, archaeal, or fungal CELLS or SPORES capable of growth on solid CULTURE MEDIA. The method is used routinely by environmental microbiologists for quantifying organisms in AIR; FOOD; and WATER; by clinicians for measuring patients' microbial load; and in antimicrobial drug testing.Serologic Tests: Diagnostic procedures involving immunoglobulin reactions.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Chronic Disease: Diseases which have one or more of the following characteristics: they are permanent, leave residual disability, are caused by nonreversible pathological alteration, require special training of the patient for rehabilitation, or may be expected to require a long period of supervision, observation, or care. (Dictionary of Health Services Management, 2d ed)Histamine H2 Antagonists: Drugs that selectively bind to but do not activate histamine H2 receptors, thereby blocking the actions of histamine. Their clinically most important action is the inhibition of acid secretion in the treatment of gastrointestinal ulcers. Smooth muscle may also be affected. Some drugs in this class have strong effects in the central nervous system, but these actions are not well understood.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Esophagitis: INFLAMMATION, acute or chronic, of the ESOPHAGUS caused by BACTERIA, chemicals, or TRAUMA.Benzimidazoles: Compounds with a BENZENE fused to IMIDAZOLES.Drug Resistance, Microbial: The ability of microorganisms, especially bacteria, to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Prospective Studies: Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Nickel: A trace element with the atomic symbol Ni, atomic number 28, and atomic weight 58.69. It is a cofactor of the enzyme UREASE.Gastric Acidity Determination: Gastric analysis for determination of free acid or total acid.Precancerous Conditions: Pathological processes that tend eventually to become malignant. (From Dorland, 27th ed)Bacterial Vaccines: Suspensions of attenuated or killed bacteria administered for the prevention or treatment of infectious bacterial disease.Case-Control Studies: Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.Esophagitis, Peptic: INFLAMMATION of the ESOPHAGUS that is caused by the reflux of GASTRIC JUICE with contents of the STOMACH and DUODENUM.RNA, Ribosomal, 16S: Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.Vacuoles: Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.Levofloxacin: The L-isomer of Ofloxacin.Anti-Infective Agents: Substances that prevent infectious agents or organisms from spreading or kill infectious agents in order to prevent the spread of infection.Treatment Outcome: Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.ColombiaDuodenum: The shortest and widest portion of the SMALL INTESTINE adjacent to the PYLORUS of the STOMACH. It is named for having the length equal to about the width of 12 fingers.Bacterial Outer Membrane Proteins: Proteins isolated from the outer membrane of Gram-negative bacteria.Esomeprazole: The S-isomer of omeprazole.Anti-Inflammatory Agents, Non-Steroidal: Anti-inflammatory agents that are non-steroidal in nature. In addition to anti-inflammatory actions, they have analgesic, antipyretic, and platelet-inhibitory actions.They act by blocking the synthesis of prostaglandins by inhibiting cyclooxygenase, which converts arachidonic acid to cyclic endoperoxides, precursors of prostaglandins. Inhibition of prostaglandin synthesis accounts for their analgesic, antipyretic, and platelet-inhibitory actions; other mechanisms may contribute to their anti-inflammatory effects.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.Cardia: That part of the STOMACH close to the opening from ESOPHAGUS into the stomach (cardiac orifice), the ESOPHAGOGASTRIC JUNCTION. The cardia is so named because of its closeness to the HEART. Cardia is characterized by the lack of acid-forming cells (GASTRIC PARIETAL CELLS).Bacterial Toxins: Toxic substances formed in or elaborated by bacteria; they are usually proteins with high molecular weight and antigenicity; some are used as antibiotics and some to skin test for the presence of or susceptibility to certain diseases.Helicobacter felis: A species of HELICOBACTER that colonizes in the STOMACH of laboratory MICE; CATS; and DOGS. It is associated with lymphoid follicular hyperplasia and mild GASTRITIS in CATS.Transformation, Bacterial: The heritable modification of the properties of a competent bacterium by naked DNA from another source. The uptake of naked DNA is a naturally occuring phenomenon in some bacteria. It is often used as a GENE TRANSFER TECHNIQUE.BulgariaRisk Factors: An aspect of personal behavior or lifestyle, environmental exposure, or inborn or inherited characteristic, which, on the basis of epidemiologic evidence, is known to be associated with a health-related condition considered important to prevent.Adenocarcinoma: A malignant epithelial tumor with a glandular organization.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Flagellin: A protein with a molecular weight of 40,000 isolated from bacterial flagella. At appropriate pH and salt concentration, three flagellin monomers can spontaneously reaggregate to form structures which appear identical to intact flagella.Bacteriological Techniques: Techniques used in studying bacteria.Immunoglobulin A: Represents 15-20% of the human serum immunoglobulins, mostly as the 4-chain polymer in humans or dimer in other mammals. Secretory IgA (IMMUNOGLOBULIN A, SECRETORY) is the main immunoglobulin in secretions.

*  Helicobacter pylori
Helicobacter pylori. Careers. Contact Us. Local: +1-305-666...
http://kidshealth.org/PageManager.jsp?dn=MiamiChildrensHospital&lic=132&article_set=22782&cat_id=20028&ps=105
*  KEGG PATHWAY: Citrate cycle (TCA cycle) - Helicobacter pylori F32
cycle (TCA cycle) - Helicobacter pylori F32 [ Pathway menu | Organism ... KEGG PATHWAY: Citrate cycle TCA cycle - Helicobacter pylori F32. Citrate cycle TCA cycle - Helicobacter pylori F32. [ Pathway menu Organism menu Pathway entry. Download KGML Show description User data mapping ]. The citrate cycle TCA cycle, Krebs cycle is an important aerobic pathway for the final steps of the oxidation of carbohydrates and fatty acids. The cycle starts with acetyl-CoA, the activated form of acetate, derived from glycolysis and pyruvate oxidation for carbohydrates and from beta oxidation of fatty acids. The two-carbon acetyl group in acetyl-CoA is transferred to the four-carbon compound of oxaloacetate to form the six-carbon compound of citrate. In a series of reactions two carbons in citrate are oxidized to CO2 and the reaction pathway supplies NADH for use in the oxidative phosphorylation and other metabolic processes. The pathway also supplies important precursor metabolites including 2-oxoglutarate. At the end of t...
http://genome.jp/kegg-bin/show_pathway?heq00020 HPF32_1288
*  KEGG PATHWAY: Sulfur metabolism - Helicobacter pylori Cuz20
Sulfur metabolism - Helicobacter pylori Cuz20. Sulfur metabolism - Helicobacter pylori Cuz20. [ Pathway menu Organism ... Sulfur metabolism - Helicobacter pylori Cuz20 [ Pathway menu | Organism menu | Pathway entry | Download KGML | Show description | User data mapping ] Sulfur is an essential element for life and the metabolism of organic sulfur compounds plays an important role in the global sulfur cycle. Sulfur occurs in various oxidation states ranging from +6 in sulfate to -2 in sulfide (H2S). Sulfate reduction can occur in both an energy consuming assimilatory pathway and an energy producing dissimilatory pathway. The assimilatory pathway, which is found in a wide range of organisms, produces reduced sulfur compounds for the biosynthesis of S-containing amino acids and does not lead to direct excretion of sulfide. In the dissimilatory pathway, which is restricted to obligatory anaerobic bacterial and archaeal lineages, sulfate (or sulfur) is the terminal electron acceptor of the respiratory chain pro...
http://genome.jp/kegg-bin/show_pathway?hpu00920
*  Helicobacter Pylori and Gastrointestinal Biology - Richard Peek
Helicobacter Pylori and Gastrointestinal Biology - Richard ... Peek. Helicobacter Pylori and Gastrointestinal Biology Peek, ... added grants:. Helicobacter pylori is the strongest identified risk...
http://grantome.com/grant/NIH/R01-DK058587-11
*  Interpretation for 35755 Helicobacter pylori Antibody, IgA, Serum
for 35755 Helicobacter pylori Antibody, IgA, Serum. Search ... Interpretation for 35755 Helicobacter pylori Antibody, IgA, Serum. Specimen Handling Collection and Preparation Instructions by Specimen Type Category A Infectious Substances Light Protection Tests Microbiology Culture Tests Resources Supply Catalog FAQ Dangerous Goods Training. My Account Report Portal Client Price Portal Additional Test Report Quality Report Portal Reportable Disease Portal Electronic Invoices Supply Catalog. Test 35755 : Helicobacter pylori Antibody, IgA, Serum Clinical Information. Exposure to Helicobacter pylori can be determined by detection of IgA, IgG, or IgM-class serum antibodies to the organism. Screening patients for the presence of antibodies to Helicobacter pylori is a convenient, noninvasive means for assessing whether a patient has been exposed to Helicobacter pylori and whether gastrointestinal symptoms may be related to Helicobacter pylori infection. Because serology may lack specificity and does not distinguis...
http://mayomedicallaboratories.com/interpretive-guide/?alpha=H&unit_code=35755
*  KEGG T01912: HPF57 0454
: HPF57_0454. Helicobacter pylori F57: HPF57_0454. Entry ... Organism hex Helicobacter pylori F57. Pathway hex00010....
http://genome.jp/dbget-bin/www_bget?hex:HPF57_0454
*  KEGG T02353: HPAKL86 01670
: HPAKL86_01670. Helicobacter pylori Aklavik86: HPAKL86_01670. Entry ... Organism hpyk Helicobacter pylori Aklavik86. Pathway hpyk00900. ... Helicobacter pylori Aklavik86: HPAKL86 01670. Definition RefSeq 1-deoxy-D-xylulose 5-phosphate reductoisomerase EC:1.1.1.267. 1-deoxy-D-xylulose-5-phosphate reductoisomerase. Organism hpyk Helicobacter pylori Aklavik86. Terpenoid backbone biosynthesis. hpyk01100. hpyk01110. Biosynthesis of secondary metabolites. hpyk01130. Biosynthesis of antibiotics. Brite KEGG Orthology KO Metabolism Metabolism of terpenoids and polyketides 00900 Terpenoid backbone biosynthesis HPAKL86 01670 Enzymes 1. Oxidoreductases 1.1 Acting on the CH-OH group of donors 1.1.1 With NAD+ or NADP+ as acceptor 1.1.1.267 1-deoxy-D-xylulose-5-phosphate reductoisomerase HPAKL86 01670. Position 321043..322143. AA seq 366 aa. NT seq 1101 nt. +upstream nt +downstream nt atggttgttttaggaagcaccggctctattgggaaaaacgctctaaaaatcgcaaaaaaa ttcaaggtaaaaatagaagccttaagctgtgggaaaaatatcgctttaatcaatgagcaa atcaaagtttt...
http://genome.jp/dbget-bin/www_bget?hpyk:HPAKL86_01670
*  KEGG PATHWAY: Biotin metabolism - Helicobacter pylori ELS37
Biotin metabolism - Helicobacter pylori ELS37. Biotin metabolism - Helicobacter pylori ELS37. [ Pathway menu Organism...
http://genome.jp/kegg-bin/show_pathway?hpe00780
*  KEGG PATHWAY: Biotin metabolism - Helicobacter pylori 2018
Biotin metabolism - Helicobacter pylori 2018 [ Pathway menu | Organism...
http://genome.jp/kegg-bin/show_pathway?hpw00780
*  Dolor abdominal, dispepsia y gastritis en pediatría: Rol del Helicobacter pylori
pediatría: Rol del Helicobacter pylori. Citado por SciELO. Citado por ... : the role of Helicobacter pylori. pediatr. Helicobacter pylori H ... pylori is the most common bacterial pathogen...
http://scielo.cl/scielo.php?script=sci_abstract&pid=S0370-41062001000200002&lng=es&nrm=iso&tlng=en
*  Gastric bacterium Helicobacter pylori protects against asthma -- ScienceDaily
... 2015 Nobel Prize in Physiology or Medicine. Gastric bacterium Helicobacter pylori protects against asthma. Date: July 5, 2011 Source: University of Zurich Summary: Infection with the gastric bacterium Helicobacter pylori provides reliable protection against allergy-induced asthma, immunologists have demonstrated in an animal model. Infection with the gastric bacterium Helicobacter pylori provides reliable protection against allergy-induced asthma, immunologists from the University of Zurich have demonstrated in an animal model together with allergy specialists from the University Medical Center of the Johannes Gutenberg University Mainz. In an article published in the Journal of Clinical Investigation, scientists from the University of Zurich and the University Medical Center of the Johannes Gutenberg University Mainz now reveal that the increase in asthma could be put down to the specific disappearance of the gastric bacterium Helicobacter pylori H. pylori protects against asthma. "Gastric bacterium Hel...
http://sciencedaily.com/releases/2011/07/110701121528.htm
*  Indications and diagnostic tests for Helicobacter pylori infection
... Recommendations for diagnostic testing for H. Helicobacter pylori in peptic ulcer disease. American College of Gastroenterology guideline on the management of Helicobacter pylori infection. Am J Gastroenterol 2007; 102:1808. Clinical utility and cost effectiveness of Helicobacter pylori testing for patients with duodenal and gastric ulcers. Am J Gastroenterol 1996; 91:228. Am J Gastroenterol 2001; 96:1409. Accuracy of Helicobacter pylori diagnostic tests in patients with bleeding peptic ulcer: a systematic review and meta-analysis. Am J Gastroenterol 2006; 101:848. Prospective comparison of commercially available rapid urease tests for the diagnosis of Helicobacter pylori. The influence of warming on rapid urease test results: a prospective evaluation. Evaluation of a new reagent strip rapid urease test for detection of Helicobacter pylori infection. A prospective evaluation of new rapid urease tests before and after eradication treatment of Helicobacter pylori, in comparison with histology, culture and ...
http://uptodate.com/contents/restless-legs-syndrome/abstract/18
*  Helicobacter Pylori (H. pylori) Causes, Symptoms, Treatment - Prevention - eMedicineHealth
Helicobacter Pylori H. pylori Causes, Symptoms, Treatment - Prevention - eMedicineHealth. Topics A-Z. Slideshow Pictures. Image Gallery. Medical Dictionary. Privacy. Site Map October 4, 2015 Like Us. digestive disorders center. digestive disorders a-z list. helicobacter pylori h. pylori article. Helicobacter Pylori H. Digestive Disease Myths Slideshow Pictures. IN THIS ARTICLE Helicobacter Pylori H. Helicobacter Pylori H. pylori Causes. Helicobacter pylori H. pylori Symptoms. When to Seek Medical Care. Helicobacter pylori H. pylori Treatment. Self-Care at Home Prevention. Read more on Helicobacter Pylori H. Helicobacter Pylori H. pylori Topic Guide. Medical Editor: Melissa Conrad St ppler, MD, Chief Medical Editor. Page 8 of 10 Glossary Helicobacter Pylori H. pylori Topic Guide. Must Read Articles Related to Helicobacter Pylori H. pylori. Dysphagia Swallowing Problems Dysphagia difficulty swallowing has many causes. learn more >>. Gastritis Gastritis is an irritation or inflammation of the lining of the stoma...
http://emedicinehealth.com/helicobacter_pylori_h_pylori/page8_em.htm
*  Category:Helicobacter pylori - Wikimedia Commons
category helicobacter pylori wikimedia commons open main menu category helicobacter pylori wikispecies has an entry on helicobacter pylori ncbi link helicobacter pylori subcategories this category has only the following subcategory a atrophic gastritis f media in category helicobacter pylori the following files are in this category out of total bacteriamente png kb empylori jpg kb h pylori ulcer diagram kb h pylori ulcer diagram kb h pylori ulcer diagram kb h pylori ulcer diagram kb h pylori ulcer ru jpg kb h pylori ulcer uk png kb h pylori virulence fac kb h pylori virulence fac kb h pylori virulence fac kb h pylori virulence fac kb h pylori virulence fac kb h pylori virulence ru svg kb h pylori virulence ru kb helicobacter pylori di kb helicobacter pylori ur kb helicobacter pylori g kb helicobacter pylori g kb helicobacter pylori s kb helicobacter pylori jpg kb helicobacter pylori jpg kb play media helicobacter pylori us mb play media helicobacter pylori us mb play media helicobacter pylori us kb play media...
https://commons.m.wikimedia.org/wiki/Category:Helicobacter_pylori
*  HPSA - Overview: Helicobacter pylori Antigen, Feces
... Test Catalog Go Test Name A. Test Catalog Test Information New Tests Test Updates Reflex Tests Referred Tests NYS Informed Consent Test List Download Catalog References Critical Values and Semi-Urgent Results Performing Locations Policies. Setup Information Test Setup AOE Codes LOINC Codes Units of Measurement. New Tests. Setup Information. Critical Values and Semi-Urgent Results. Referred Tests. Test Ordering MayoACCESS Overview References MayoLINK Overview References. Specimen Handling Collection and Preparation Instructions by Specimen Type Category A Infectious Substances Light Protection Tests Microbiology Culture Tests Resources Supply Catalog FAQ Dangerous Goods Training. Outreach Resources Outreach Areas Outreach Education Support Services Operations Sales and Marketing Billing and Finance Examples. My Account Report Portal Client Price Portal Additional Test Report Quality Report Portal Reportable Disease Portal Electronic Invoices Supply Catalog. Test ID: HPSA Helicobacter pylori Antigen, Feces...
http://mayomedicallaboratories.com/test-catalog/Overview/81806
*  Interpretation for 35755 Helicobacter pylori Antibody, IgA, Serum
... Specimen Handling Collection and Preparation Instructions by Specimen Type Category A Infectious Substances Light Protection Tests Microbiology Culture Tests Resources Supply Catalog FAQ Dangerous Goods Training. My Account Report Portal Client Price Portal Additional Test Report Quality Report Portal Reportable Disease Portal Electronic Invoices Supply Catalog. Test 35755 : Helicobacter pylori Antibody, IgA, Serum Clinical Information. Exposure to Helicobacter pylori can be determined by detection of IgA, IgG, or IgM-class serum antibodies to the organism. Screening patients for the presence of antibodies to Helicobacter pylori is a convenient, noninvasive means for assessing whether a patient has been exposed to Helicobacter pylori and whether gastrointestinal symptoms may be related to Helicobacter pylori infection. Because serology may lack specificity and does not distinguish between recent or remote infection, active disease is best diagnosed by the Helicobacter pylori stool HPSA / Helicobacter pyl...
http://mayomedicallaboratories.com/interpretive-guide/index.html?alpha=H&unit_code=35755
*  Helicobacter Pylori (H. pylori) Causes, Symptoms, Treatment - When to Seek Medical Care - eMedicineH
Helicobacter Pylori H. pylori Causes, Symptoms, Treatment - When to Seek Medical Care - eMedicineHealth. Home. Topics A-Z. Slideshow Pictures. Image Gallery. Medications. Quizzes. Medical Dictionary. . About Us. Privacy. Site Map October 6, 2015 Like Us. Follow Us. home. digestive disorders center. digestive disorders a-z list. helicobacter pylori h. pylori article. Font Size. A A A. Previous 1 2 3 4. 5 6 ... Next. Page 4 of 10 Glossary. Helicobacter Pylori H. pylori cont. Take the Tummy Trouble Quiz. Digestive Disease Myths Slideshow Pictures. Hemorrhoids Slideshow: Does Everyone Have Them. IN THIS ARTICLE Helicobacter Pylori H. pylori Overview. Helicobacter Pylori H. pylori Causes. Helicobacter pylori H. pylori Symptoms. When to Seek Medical Care. Exams and Tests. Helicobacter pylori H. pylori Treatment. Self-Care at Home. Prevention. Outlook. Read more on Helicobacter Pylori H. pylori from Healthwise. Helicobacter Pylori H. pylori Topic Guide. When to Seek Medical Care. It is always appropriate to see your...
http://emedicinehealth.com/helicobacter_pylori_h_pylori/page4_em.htm
*  duodenal gastrinoma secondary to chronic Helicobacter pylori (...) - Humpath.com - Human pathology
duodenal gastrinoma secondary to chronic helicobacter pylori humpath com human pathology humpath com human pathology a molecular pathology b cellular pathology c tissular pathology d systemic pathology e pathology by systems f pathology by regions g tumoral pathology h case records j books k info admin resources in pathology technical section home e pathology by systems digestive system small intestine duodenum duodenal gastrinoma secondary to chronic helicobacter pylori duodenal gastrinoma secondary to chronic helicobacter pylori gastritis thursday august reference duodenal gastrinoma with multiple gastric neuroendocrine tumors secondary to chronic helicobacter pylori gastritis grin a kim yi mustard r streutker cj riddell rh am j surg pathol jun pmid e pathology by systems cardiovascular system digestive system anus colon and rectum liver stomach pancreas appendix small intestine duodenum ampulla of vater ileum esophagus endocrine system genital system locomotory system nervous system respiratory system skin...
http://humpath.com/spip.php?article18713
*  Letter: sequential therapy for Helicobacter pylori eradication in children ' updated meta-analysis o
... f randomized controlled trials - Horvath - 2013 - Alimentary Pharmacology Therapeutics - Wiley Online Library. Wiley s Gastroenterology Collection. Letters to the Editors You have free access to this content Letter: sequential therapy for Helicobacter pylori eradication in children ' updated meta-analysis of randomized controlled trials. 2013 , Letter: sequential therapy for Helicobacter pylori eradication in children ' updated meta-analysis of randomized controlled trials. ARTICLE TOOLS Get PDF 179K Get PDF 179K. References. Get PDF 179K Get PDF 179K. Sirs , Previously, we have shown in a meta-analysis that 10-day sequential therapy compared with standard triple therapy may be considered as an option for increasing the eradication rates in children with Helicobacter pylori H. Recently, one of the randomized controlled trials RCTs included in our meta-analysis has been retracted by the editors of the Journal of Pediatric Gastroenterology and Nutrition after finding issues related to the institutional revi...
http://onlinelibrary.wiley.com/doi/10.1111/apt.12258/full
*  KEGG PATHWAY: Epithelial cell signaling in Helicobacter pylori infection - Reference pathway
... Epithelial cell signaling in Helicobacter pylori infection - Reference pathway. [ Pathway menu Organism menu Pathway entry. Show description User data mapping ]. Two major virulence factors of H. pylori are the vacuolating cytotoxin VacA and the cag type-IV secretion system T4SS and its translocated effector protein, cytotoxin-associated antigen A CagA. VacA binds to lipid rafts and glycosylphosphatidylinositol-anchored proteins GPI-APs of the target cell membrane. After insertion into the plasma membrane, VacA channels are endocytosed and eventually reach late endosomal compartments, increasing their permeability to anions with enhancement of the electrogenic vacuolar ATPase v-ATPase proton pump. This leads to water influx and vesicle swelling, an essential step in vacuole formation. In addition, it is reported that the VacA cleavage product binds to the tyrosine phosphatase receptor zeta Ptprz on epithelial cells and the induced signaling leads to the phosphorylation of the G protein-coupled receptor k...
http://genome.jp/kegg-bin/show_pathway?28671/map05120.args
*  Helicobacter Pylori: H Pylori Symptoms, Diet, Test
... Pill Identifier Search. Drugs A-Z. Pill Identifier. Supplements. Slideshows. Images. Symptom Checker. Diseases. Dictionary. helicobacter pylori article. Helicobacter Pylori cont. Foods to Eat, Foods to Avoid Slideshow. Medical Author: Charles Patrick Davis, MD, PhD. Charles Patrick Davis, MD, PhD Dr. Charles "Pat" Davis, MD, PhD, is a board certified Emergency Medicine doctor who currently practices as a consultant and staff member for hospitals. He has a PhD in Microbiology UT at Austin, and the MD Univ. He is a Clinical Professor retired in the Division of Emergency Medicine, UT Health Science Center at San Antonio, and has been the Chief of Emergency Medicine at UT Medical Branch and at UTHSCSA with over 250 publications. Medical Editor: Jay W. Marks, MD. Jay W. Marks, MD Jay W. He graduated from Yale University School of Medicine and trained in internal medicine and gastroenterology at UCLA/Cedars-Sinai Medical Center in Los Angeles. In this Article Helicobacter pylori H. What is Helicobacter pylori....
http://rxlist.com/helicobacter_pylori/page8.htm
*  Prevalence of Helicobacter pylori in patients with gastro-oesophageal reflux disease: systematic rev
... iew. The BMJ. Prevalence of Helicobacter pylori in patients with gastro-oesophageal reflux disease: systematic review. Papers Prevalence of Helicobacter pylori in patients with gastro-oesophageal reflux disease: systematic review. a Centre for Integrated Health Care Research, Wolfson Research Institute, University of Durham, Stockton on Tees TS17 6BH b Department of Mathematical Sciences, Statistics and Mathematics Consultancy Unit, University of Durham, Science Laboratories, Durham DH1 3LE c Information Management Research Institute, School of Information Studies, University of Northumbria, Newcastle upon Tyne NE1 8ST Correspondence to: A Raghunath. Abstract. We included studies to November 2001 fulfilling certain eligibility criteria box by searching Medline, Embase, Cinahl, and Cochrane, using subject terms and text words. Studies included in systematic review. Four studies showed a higher prevalence of H pylori infection among patients with gastro-oesophageal reflux disease, but not significantly so f...
http://bmj.com/content/326/7392/737.1.long
*  Helicobacter Pylori Bacteria - Mary Greeley Medical Center
... Health Wellness. About Mary Greeley. Health Wellness. Health Library. Helicobacter Pylori Bacteria. Health Library Helicobacter Pylori Bacteria. Topic Overview. Peptic Ulcer. Helicobacter Pylori Bacteria Skip to the navigation Topic Overview Helicobacter pylori is a type of bacteria that is a major cause of stomach gastric and upper small intestine duodenal ulcers. Infection with H. H pylori bacteria can cause ulcers by growing in the lining of the stomach, producing inflammation and causing the stomach and intestinal lining to be more easily damaged by stomach acid. pylori do not develop ulcers. People who have had a peptic ulcer and are infected with H. pylori need treatment to cure the infection to lower their risk of getting another peptic ulcer. pylori infection. pylori bacteria are resistant to certain antibiotics, which can keep the medicine from killing the bacteria. Related Information Helicobacter Pylori Tests. American College of Gastroenterology guideline of the management of Helicobacter pyl...
http://mgmc.org/wellness/health-library/healthwise-document-viewer/?id=abh0960
*  ICD-9-CM Diagnosis Code 041.86 : Helicobacter pylori [H. pylori]
ICD-9-CM Diagnosis Code 041.86 : Helicobacter pylori. Home > 2015 ICD-9-CM Diagnosis Codes > Infectious And Parasitic Diseases 001-139 > Other Bacterial Diseases 030-041 > Bacterial infection in conditions classified elsewhere and of unspecified site 041- 2015 ICD-9-CM Diagnosis Code 041.86 Helicobacter pylori 2015. ICD-9-CM 041.86 is a billable medical code that can be used to indicate a diagnosis on a reimbursement claim, however, 041.86 should only be used for claims with a date of service on or before September 30, 2015. For claims with a date of service on or after October 1, 2015, use an equivalent ICD-10-CM code or codes. Convert to ICD-10-CM : 041.86 converts directly to: 2015/16 ICD-10-CM B96.81 Helicobacter pylori as the cause of diseases classified elsewhere Disease Synonyms Gastric ulcer due to h pylori Gastritis, Helicobacter pylori H pylori gastritis H pylori infection Helicobacter blood test positive Helicobacter breath test positive Helicobacter pylori gastrointestinal tract infection Helicoba...
http://icd9data.com/2015/Volume1/001-139/030-041/041/041.86.htm
*  JAMA Network | JAMA Internal Medicine | Eradication of Helicobacter pylori May Be Beneficial in t
Previous Article Next Article. Article. Figures Tables. ARTICLE INFORMATION. Figures in this Article. View Large | Save Table | Download Slide .ppt | View in Article Context. View Large | Save Table | Download Slide .ppt | View in Article Context. Table 3 and Figure 1, Figure 2, Figure 3, and Figure 4 detail and illustrate the glaucoma parameters in all glaucomatous eyes n = 74 of the 41 patients at baseline and 1 and 2 years after treatment. View Large | Save Table | Download Slide .ppt | View in Article Context. Mean intraocular pressure at baseline and 1 and 2 years after treatment in patients for whom Helicobacter pylori treatment was successful group A ; those for whom eradication of H pylori had failed group B ; and those who were H pylori negative at baseline group C. View Large | Save Figure | Download Slide .ppt | View in Article Context. Mean defect values at baseline and 1 and 2 years after treatment in patients for whom Helicobacter pylori treatment was successful group A ; those for whom eradicat...
http://archinte.jamanetwork.com/article.aspx?articleid=211510
*  JAMA Network | JAMA Internal Medicine | Effectiveness of Helicobacter pylori Therapies in a Clini
Previous Article Next Article. Article. PARTICIPANTS AND METHODS. COMMENT. ARTICLE INFORMATION. Figures in this Article. Therapeutic Regimens Used by 38 Physicians to Treat 250 Patients With Helicobacter pylori Infection*. View Large | Save Table | Download Slide .ppt | View in Article Context. View Large | Save Table | Download Slide .ppt | View in Article Context. Patients receiving a 2- or 3-times-a-day regimen MOC, OAC, OC, and omeprazole and amoxicillin were significantly more compliant took ≥80% of medication P .02 than those receiving a 4-times-a-day regimen BMT and omeprazole with BMT Table 2. View Large | Save Table | Download Slide .ppt | View in Article Context. View Large | Save Figure | Download Slide .ppt | View in Article Context. This study reveals substantial practice variation in the clinical indications for the treatment of H pylori infection, the method of diagnosing H pylori infection, the choice of anti– H pylori therapeutic regimens, the effectiveness of the regimens, and the cost-effec...
http://archinte.jamanetwork.com/article.aspx?articleid=485091
*  Helicobacter pylori Infection and Upper Gastrointestinal Disorders
... Submit a Manuscript. Table of Contents Journal Menu. About this Journal ·. Submit a Manuscript ·. Table of Contents. Open Special Issues ·. Published Special Issues ·. Special Issue Guidelines. Helicobacter pylori Infection and Upper Gastrointestinal Disorders Guest Editors: Vikram Kate, N. Ananthakrishnan, Frank I. Helicobacter pylori Infection and Upper Gastrointestinal Disorders, Vikram Kate, Nanda K. Ananthakrishnan Volume 2013 2013, Article ID 896209, 3 pages. Helicobacter pylori -Induced Chronic Gastritis and Assessing Risks for Gastric Cancer, Gonzalo Carrasco and Alejandro H. Is Helicobacter pylori Infection the Primary Cause of Duodenal Ulceration or a Secondary Factor. Ananthakrishnan, and Frank I. Tovey Volume 2013 2013, Article ID 425840, 8 pages. Serum Prohepcidin Levels Are Lower in Patients with Atrophic Gastritis, Hyung-Keun Kim, Eun-Chul Jang, Ju-Ok Yeom, Sun-Young Kim, Hyunjung Cho, Sung Soo Kim, Hiun-Suk Chae, and Young-Seok Cho Volume 2013 2013, Article ID 201810, ...
http://hindawi.com/journals/grp/si/540452/
*  Helicobacter pylori (strain Shi470)
Helicobacter pylori strain Shi470. p>An evidence describes the source of an annotation, e.g. an experiment that has been published in the scientific literature, an orthologous protein, a record from another database, etc. /p> p> a href="/manual/evidences">More… /a> /p>. Taxonomy. x UniProtKB Protein knowledgebase UniParc Sequence archive Help Help pages, FAQs, UniProtKB manual, documents, news archive and Biocuration projects. UniRef Sequence clusters Proteomes Protein sets from fully sequenced genomes Annotation systems Systems used to automatically annotate proteins with high accuracy: UniRule Manually curated rules. Supporting data Select one of the options below to target your search: Literature citations. Taxonomy. Keywords. Subcellular locations. Cross-referenced databases. Human diseases. BLAST. Align. Retrieve/ID mapping. Help. Taxonomy - Helicobacter pylori strain Shi470. Basket 0 max 400 entries x Your basket is currently empty. Select item s and click on "Add to basket" to cr...
http://uniprot.org/taxonomy/512562
*  BioProduct: Immunology: ELISA: Helicobacter Pylori IgG ELISA: Helicobacter Pylori IgG ELISA
bioproduct immunology elisa helicobacter pylori igg elisa helicobacter pylori igg elisa biojob bioblog pubalert biotool bioproduct bioforum protocol home bioproduct home add products edit products new products edit profile login sign up search products advanced search bioproduct immunology elisa helicobacter pylori igg elisa previous next product name helicobacter pylori igg elisa product page visit the product product description the helicobacter pylori igg test kit is intended for the qualitative determination of helicobacter pylori igg in human serum also offer a quantitative kit and a helicobacter pylori igm elisa kit product manual read product manual price specification kit wells product review vendor information prolias http www shopprolias com crabbs branch way rockville md usa phone fax e mail info prolias us about terms of service privacy feedback sponsorship protocol online all rights reserved...
http://protocol-online.org/bioproduct/Product_listing/179.html
*  Helicobacter Pylori Tests | UW Health |
Helicobacter Pylori Tests. UW Health. American Family Children's Hospital Home. pylori infection in the stomach and upper part of the small intestine duodenum. pylori : Blood antibody test. pylori bacteria. Urea breath test. pylori bacteria in your stomach. pylori infection. pylori infection H. Stomach biopsy. Several different tests may be done on the biopsy sample. pylori test is done to: Find out whether an infection with H. Stomach biopsy or urea breath test Do not eat or drink for at least 6 hours before a breath test or a stomach biopsy. How It Is Done Blood antibody test The health professional taking a sample of your blood will: Wrap an elastic band around your upper arm to stop the flow of blood. Stomach biopsy Endoscopy is used to collect samples of tissue from the stomach and duodenum. How It Feels Blood antibody test The blood sample is taken from a vein in your arm. Risks Blood antibody test There is very little chance of a problem from having a blood sample taken from a vein., stomach, or duoden...
http://uwhealth.org/health/topic/medicaltest/helicobacter-pylori-tests/hw1531.html
*  Ulcers - JFK Medical Center | Atlantis, FL
Fish Oil Garlic Rhubarb Sea Buckthorn Oil Turmeric Vitamin B 12 Vitamin C Vitamin E. Principal Proposed Natural Treatments Other Proposed Natural Treatments Alternative Therapies Herbs and Supplements to Use Only With Caution References. pylori on its own, preliminary studies, including several small, double-blind trials, suggest that probiotics may help standard antibiotic therapy work better, reducing side effects, and improving the rate of eradication. Effect of Lactobacillus GG supplementation on antibiotic-associated gastrointestinal side effects during Helicobacter pylori eradication therapy: a pilot study. Effect of Lactobacillus GG supplementation on antibiotic-associated gastrointestinal side effects during Helicobacter pylori eradication therapy: a pilot study. Lactobacillus acidophilus administration added to omeprazole/amoxycillin-based double therapy in Helicobacter pylori eradication. Effect of different probiotic preparations on anti-helicobacter pylori therapy-related side effects: a parallel ...
http://jfkmc.com/your-health/condition_detail.dot?id=21594&lang=English&db=hlt&ebscoType=healthlibrary&widgetTitle=FOR ALL HOSTS (GLOBAL) *** EBSCO - Condition Detail v2
*  Ulcers - Kendall Regional Medical Center | Miami, FL
Health Library. Fish Oil Garlic Rhubarb Sea Buckthorn Oil Turmeric Vitamin B 12 Vitamin C Vitamin E. pylori on its own, preliminary studies, including several small, double-blind trials, suggest that probiotics may help standard antibiotic therapy work better, reducing side effects, and improving the rate of eradication. Effect of Lactobacillus GG supplementation on antibiotic-associated gastrointestinal side effects during Helicobacter pylori eradication therapy: a pilot study. Effect of Lactobacillus GG supplementation on antibiotic-associated gastrointestinal side effects during Helicobacter pylori eradication therapy: a pilot study. Lactobacillus acidophilus administration added to omeprazole/amoxycillin-based double therapy in Helicobacter pylori eradication. Effect of different probiotic preparations on anti-helicobacter pylori therapy-related side effects: a parallel group, triple blind, placebo-controlled study. Probiotic supplementation improves tolerance to Helicobacter pylori eradication therapy a ...
http://kendallmed.com/your-health/?/21594/Ulcers--Protection
*  Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. Prevalence o
... f Helicobacter pylori infection and histologic gastritis in asymptomatic persons. Abstracts Health. Search abstracts:. . Abstracts. Health. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii Article Abstract: To evaluate the extent to which infection with Helicobacter pylori is a risk factor for gastric carcinoma stomach cancer, a study was carried out on American men of Japanese ancestry living in Hawaii. This group has a high incidence of gastric carcinoma. The subjects were 5,908 men born between 1900 and 1919 who underwent medical examinations between 1967 and 1970. The examinations included taking blood samples, which were frozen and stored for subsequent analysis. A total of 137 cases of gastric carcinoma intestinal, diffuse, and unknown types had been diagnosed in the group by 1989: for 109 subjects, blood samples and sufficient additional information were available for inclusion in the study. These subjects cases were matched with controls for age at examination...
http://readabstracts.com/Health/Helicobacter-pylori-infection-and-gastric-carcinoma-among-Japanese-Americans-in-Hawaii.html
*  Helicobacter Pylori - Symptoms, Diagnosis, Treatment of Helicobacter Pylori - NY Times Health Inform
... ation. Log In Register Now Help. Home Page Today's Paper Video Most Popular Times Topics. Search All NYTimes.com. Health Guide. World U.S. N.Y. / Region Business Technology Science Health Research Fitness Nutrition Money Policy Views Health Guide. Sports Opinion Arts Style Travel Jobs Real Estate Autos. Search Health 3,000+ Topics. Send Feedback. Health. Times Health Guide. h. Helicobacter Pylori. Helicobacter Pylori. Overview Alternative Names Causes Symptoms Exams and Tests Treatment Outlook Prognosis Possible Complications When to Contact a Medical Professional Prevention References. News & Features. Illustrations. Digestive System. Helicobacter pylori H. pylori is the bacteria responsible for most ulcers and many cases of stomach inflammation chronic gastritis. The bacteria can weaken the protective coating of the stomach, allowing digestive juices to irritate the sensitive stomach lining. See All » News Features. Really. The Claim: Ulcers increase the risk of diabetes. In Some Cases, Even Bad Bacteri...
http://nytimes.com/health/guides/disease/helicobacter-pylori
*  Helicobacter Pylori (Stomach Infection) - Lancaster Gastroenterology Procedure Center
Helicobacter Pylori Stomach Infection - Lancaster Gastroenterology Procedure Center. Accreditation. Stop Colon Cancer Now. Why Choose an ASC. Our Commitment to You. Newsletter Sign Up. Key Staff. Local Associations. Value Certified Provider. Contact Us. Directions. Online Bill Pay. Request an Appointment. Physicians. Our Procedures. Conditions. Patient Forms. Insurance and Billing. Express Scheduling. Online Bill Pay. Request an Appointment. Colon & Colorectal Cancer. Crohn's Disease. Gastrointestinal and Gastroenterologist. Heartburn, Acid Reflux & GERD. Helicobacter Pylori Stomach Infection. Liver Disease. Peptic Ulcer Disease PUD. Stomach Problems and Swallowing Problems. Ulcerative Colitis. Conditions. Helicobacter Pylori Stomach Infection. Helicobacter Pylori Stomach Infection Overview. Helicobacter pylori H. pylori is a bacterium that causes inflammation of the stomach, chronic gastritis, and ulcers in the stomach or small intestine. Most people with an H. pylori infection never experience symptoms. Whe...
http://lancastergicenter.com/condition/helicobacter-pylori-stomach-infection
*  Pylori
... Home. Biology. Medicine. Technology. Products. News. Definition. Dictionary. Movies. Links. Tags. Search. RSS Navigation Links Biology News Medicine News Biology Products Medicine Products Biology Definition Medicine Definition Biology Technology Medicine Technology Biology Dictionary Medicine Dictionary. Pylori in Medical News. Peptic ulcer bacterium alters the body's defense system ... Helicobacter pylori survives in the body by manipulating important ... of the world's population carries Helicobacter pylori, mainly in the stomach. Most infected ... the body's defence against Helicobacter pylori and thereby enable the bacterium to develop a ... Simple measures may prevent transmission of stomach ulcer bacteria ... The stomach ulcer bacterium Helicobacter pylori is not transmitted through drinking water as ... for a short period of time, since Helicobacter pylori is not able to survive for long outside the ... in Bangladesh, where the bacterium Helicobacter pylori is very common. The results show that w...
http://bio-medicine.org/q/pylori/
*  Helicobacter Pylori - Bacteria Helicobacter Pylori
... Directory Column 1. Visit the Directory homepage Most Popular. Kids Clothing. Job Search. Prams, Strollers, Accessories. Childcare, Nanny & Babysitter. Party Venues. Baby Furniture, Decor & Bedding. Savings & Specials. Column 2. Shopping. Breastfeeding Products. Toilet Training Accessories. Organic Clothings. Baby Hampers & Gift Ideas. Delivery: Meals, Groceries & Gifts. Swimwear. Baby and Kids Formalwear. Column 3. Things To Do. Events, Theatre, Carnivals, Festivals. After School: Activities & Classes. Massage & Pampering. Family Fun. Zoo, Aquarium or Theme Park. Kids' Activities. Dance: Ballet, Hip Hop & More. Martial Arts: Karate, Krav Maga, Etc. Swimming. Soccer. Gymnastics & Cheerleading. Pregnancy Column 1. Visit the Pregnancy homepage Conception. Getting pregnant. Fertility. IVF. Real life. Baby names. Naming your baby. Baby name ideas. Baby name finder. Column 2. Pregnancy. Signs and symptoms. Pregnancy testing. Miscarriage. Pregnancy health. Real life. Pregnancy galleries. Tools. Ovulation calcu...
http://kidspot.com.au/familyhealth/schoolzone/Infections-and-Diseases-Stomach-and-intestinal-Helicobacter-Pylori 2290 194 article.htm
*  Studies on Nutrition and Helicobacter pylori infection
... Follow us. Home About NaturalNews Contact Us Write for NaturalNews Media Info Advertise with Natural News. Foods and Ingredients Superfoods Food Additives Sweeteners Nutritional Supplements Individual Nutrients Vitamins Minerals Amino Acids Nutrition Concepts Diets Plants, Herbs Spices Phytochemicals Chemicals Harmful Toxins Heavy Metals Drugs Pharmacological Actions Adverse Reactions Health Concerns Healing Therapies Harmful Therapies Body Organs and Systems Earth Sciences Environment. Studies on Nutrition and Helicobacter pylori infection. Tweet. Effect of Helicobacter pylori infection and its eradication on nutrition. 2002 Alimentary pharmacology & therapeutics CDH1 gene polymorphisms, smoking, Helicobacter pylori infection and the risk of gastric cancer in the European Prospective Investigation into Cancer and Nutrition EPIC-EURGAST. 2008 European journal of cancer Oxford, England : 1990 Alcohol consumption and Helicobacter pylori infection: results from the German National Health and Nutrition Surve...
http://science.naturalnews.com/N/Nutrition_and_Helicobacter_pylori_infection.html
*  Resistance of Helicobacter pylori to antibiotics from 2000 to 2009 in Shanghai.
... Article Resistance of Helicobacter pylori to antibiotics from 2000 to 2009 in Shanghai. pylori strains were collected from 2000 to 2009 in Shanghai and tested for their susceptibility to metronidazole, clarithromycin, amoxicillin, furazolidone, levofloxacin and tetracycline using agar dilution. The resistant rates of H. ABSTRACT: To test the efficacy of lansoprazole, bismuth, levofloxacin, and amoxicillin therapy compared to bismuth metronidazole tetracycline BMT quadruple therapy for second-line treatment of Helicobacter pylori infection. Page 1 BRIEF ARTICLE Resistance of Helicobacter pylori to antibiotics from 2000 to 2009 in Shanghai Qin-Juan Sun, Xiao Liang, Qing Zheng, Wei-Qi Gu, Wen-Zhong Liu, Shu-Dong Xiao, Hong Lu Qin-Juan Sun, Xiao Liang, Qing Zheng, Wei-Qi Gu, Wen- Zhong Liu, Shu-Dong Xiao, Hong Lu, Department of Gas- troenterology, Shanghai Renji Hospital, Shanghai Institute of Digestive Disease, Shanghai Jiaotong University School of Medicine, Shanghai 200001, China Author contributions: Sun...
http://researchgate.net/publication/47546215_Resistance_of_Helicobacter_pylori_to_antibiotics_from_2000_to_2009_in_Shanghai
*  Helicobacter pylori | bacterium | Britannica.com
. Helicobacter pylori. bacterium. Britannica.com. Shop. School and Library Subscribers. JOIN. LOGIN. Activate Your Free Trial. Stories. quizzes. galleries. lists. Helicobacter pylori. Bacterium. Contribute your ideas for this topic. Thank you for helping us expand this topic. Simply begin typing or use the editing tools above to add to this article. Once you are finished and click submit, your modifications will be sent to our editors for review. Ads by Google. This topic is discussed in the following articles: gastritis digestive system disease : Gastritis ...days. Aspirin and NSAIDs taken for arthritis cause erosions in the antrum of the stomach and in some instances cause bleeding and chronic ulceration. Infection by the bacteria H. pylori is also a common cause of chronic gastritis. This usually responds to the withdrawal of the offending drugs and treatment with the same agents used to treat peptic ulcers of the... gastritis Chronic gastritis may be caused by prolonged use of aspirin or nonsteroidal anti...
http://britannica.com/science/Helicobacter-pylori
*  Helicobacter pylori | Clinical Diagnostics | Bio-Rad
Helicobacter pylori. Home > Clinical Diagnostics > Products > Microbiology > Serology > Other Serology > Helicobacter pylori. Helicobacter pylori Print. Email. Helicobacter pylori Testing Pylori Detect IgG and IgA EIAs Assay Precision The intra- and inter-assay precision were calculated by running three patient sera negative, low positive, and high positive in 24replicates using two independent operators. Pylori Detect IgG. Serum 1 Serum 2 Serum 3. Operator 1 CV Intra-Assay 3.85% 4.79% 1.39%. Operator 2 CV Intra-Assay 3.22% 5.91% 1.56%. Inter-Assay CV 4.35% 6.86% 5.53%. Pylori Detect IgA. Serum 1 Serum 2 Serum 3. Operator 1 CV Intra-Assay 7.94% 2.81% 4.94%. Operator 2 CV Intra-Assay 4.43% 2.97% 4.42%. Inter-Assay CV 7.61% 4.19% 4.86%. Interpretation of Results Using ELISA Values ELISA. Interpretation. 1.0 Positive. Pylori Detect IgG and Pylori Detect IgA are immunoenzymatic assays using highly purified, specific antigens for qualitative determination of IgG or IgA antibodies. What is the education discoun...
http://bio-rad.com/en-us/product/other-serology/helicobacter-pylori
*  How long will it take to feel better after my h pylori is gone - I was diagnosed with h pylori and h
Q How long will it take to feel better after my h pylori is gone. Tweet. Was this answer helpful. Comment. Reply. Report. How long does it take to treat helicobacter pylori. This answer closely relates to: H pylori treatment when will symptoms disappear. After triple therapy treatment how long does it take for you to start feeling better. How long until you feel better from helicobacter pylori once begin medication. source : How long until you feel better from helicobacter pylori once begin medication. This answer closely relates to: H pylori treatment how long does it take to feel better. Once i start my prevpac for h pylori how long does it take to feel better. Add Your Answer How long will it take to feel better after my h pylori is gone. 50% - How long until feel better after getting rid of h pylori how long until feel better after getting rid of h pylori. - H pylori how long to feel better once medicated How long it takes to feel better soon you start the h pylori treatment. - H pylori when will i feel b...
http://answeranimal.com/How_long_will_it_take_to_feel_better_after_my_h_pylori_is_gone-qna27495.html
*  Helicobacter pylori - MicrobeWiki
... Helicobacter pylori. Helicobacter pylori is a Gram-negative organism that has a helical or spiral shape and has 6-8 flagella at one end. H pylori are a slow growing organisms that can cause peptic ulcers and gastritis that can lead to gastric cancer and gastric MALT mucosa-associated lymphoid tissue lymphoma. pylori were related to peptic ulcers. pylori was shown to be different from the Campylobacter genus. In 1989, CagA gene was found and identified as the marker strain of the risk of peptic ulcers and gastric cancer. The CagA pathogenicity island recognizes the type IV secretion system, which CagA proteins are moved to the host cells. Cell structure and metabolism. pylori feed off the superoxide radicals on the stomach lining of the cells. The motility of the bacteria, the flagella and the shape favors colonization which allows spiral shape to excavate through the lining. Primary antibiotic resistance in Helicobacter pylori strains isolated in northern and central Italy. The two strains were isolated ...
http://microbewiki.kenyon.edu/index.php/Helicobacter_pylori
*  Helicobacter Pylori Infection - Danville Regional Medical Center | Danville, VA
Helicobacter Pylori Infection - Danville Regional Medical Center. Danville, VA. Danville Regional Medical Center. Careers. Contact Us. Directions. Find a Physician. Services. Services Heart Center. Cancer Center. Surgical Services. Medical Specialties. Rehabilitation Services. Women’s Services. More Services. Danville Regional provides over 25 medical specialties and 14 surgical services to the community. Resources. Resources For Patients. Maps & Directions. Volunteer Services. Classes & Events. Blood Donor Center. Health Insurance Marketplaces. Whether you are a patient or visitor at Danville Regional Medical Center, we want your experience with us to be as pleasant as possible. Health Information. Health Information Health Library. Infection Prevention Information. Virtual Body. Health Information Videos. Health eCooking. Recent Health News. Regional Report Card. Health Talk: Showcase Magazine. An extensive library of Health Information is right here at your fingertips. For Professionals Career Center. Resi...
http://danvilleregional.com/your-health/?/643925/
*  H. pylori infection Prevention - Mayo Clinic
pylori infection Prevention - Mayo Clinic. pylori infection. By Mayo Clinic Staff. H pylori infection occurs when a type of bacteria called Helicobacter pylori H. A common cause of peptic ulcers, H. If you develop signs and symptoms of a peptic ulcer, your doctor will probably test you for H. pylori infection will never have any signs or symptoms. pylori infection, they may include:. pylori infection are related to living conditions in your childhood, such as:. People living in developing countries, where crowded and unsanitary living conditions may be more common, have a higher risk of H. pylori infection. pylori infection. pylori infection include:. Ulcers. Stomach cancer. H pylori infection is a strong risk factor for certain types of stomach cancer. pylori infection. pylori infection, some basic questions to ask your doctor include:. pylori infection include:. Breath test. Acid-suppressing drugs known as proton pump inhibitors PPIs, bismuth subsalicylate Pepto-Bismol and antibiotics can interfere with the...
http://mayoclinic.org/diseases-conditions/h-pylori/basics/prevention/CON-20030903?p=1
*  Helicobacter pylori Ab | Clinical Diagnostics | Bio-Rad
Helicobacter pylori Ab. Clinical Diagnostics. Bio-Rad. Home > Clinical Diagnostics > Products > Microbiology > Serology > Other Serology Assays > Helicobacter pylori Ab. Helicobacter pylori Ab Print. Email. Ordering. Helicobacter pylori is a spiral-shaped, Gram-negative bacillus causing a number of inflammatory gastrointestinal diseases. H pylori infection is detected in 90% of patients with duodenal ulcer and 70% of patients with gastric ulcer. pylori eradication to ensure lasting and effective cure of duodenal ulcer has been clearly demonstrated. Serology provides a minimally-invasive, sensitive and easy-to-perform method for the determination of H. pylori infection. Platelia H. pylori IgG is an immunoenzymatic assay for qualitative determination of IgG antibodies. pylori ELISA assays are used for quantitative determination of IgG, IgA or IgM specific antibodies. What is the education discount policy. For more than 15 years, Bio-Rad has made science education a major priority. To support this effort, th...
http://bio-rad.com/en-ca/product/other-serology-assays/helicobacter-pylori-ab
*  Ulcers | Orange Park Medical Center | Orange Park, FL
Orange Park Medical Center. Orange Park, FL. H2U - health to you. Health Info. Health Info Health Info. Health Library. H2U - health to you. Islam Tafish Joins Orange Park Medical Center Orange Park Medical Center is pleased to announce that Islam Tafish, MD has joined the hospital’s medical staff and First Coast Neurology, with offices in Orange Park and Fleming Island. Orange Park Medical @opmedcenter Welcome Interventional Neurologist Islam Tafish, MD. pylori on its own, preliminary studies, including several small, double-blind trials, suggest that probiotics may help standard antibiotic therapy work better, reducing side effects, and improving the rate of eradication. Effect of Lactobacillus GG supplementation on antibiotic-associated gastrointestinal side effects during Helicobacter pylori eradication therapy: a pilot study. Effect of Lactobacillus GG supplementation on antibiotic-associated gastrointestinal side effects during Helicobacter pylori eradication therapy: a pilot study. Lactobacillus acidop...
http://orangeparkmedical.com/hl/?/21594/Ulcer-Prevention
*  H. pylori IgG II
Home Biology Medicine Technology Products News Definition Dictionary Movies Links Tags Search RSS Navigation Links Biology News Medicine News Biology Products Medicine Products Biology Definition Medicine Definition Biology Technology Medicine Technology Biology Dictionary Medicine Dictionary HOME >> MEDICINE >> PRODUCTS H. pylori IgG II Products H. pylori IgG II Company Inverness Medical Innovations Item H. pylori IgG II Features All kits include the following: 12 x 8 well strips with breakaway wells Controls and calibrators TMB substrate Stop solution Directional insert Sample diluent Conjugate Wash buffer Description Our breadth of infectious disease ELISA products make us a leader in this field. With standard assay protocols for faster integration into the busy laboratory, our Infectious Disease ELISA products provide increased reliability and run-to-run consistency. Our Infectious Disease ELISA menu includes antibody detection assays for a wide range of serological assays including ToRCH, EBV, H. pylori ...
http://bio-medicine.org/medicine-products/H--pylori-IgG-II-21344-1/
*  Architecture of the Helicobacter pylori Cag-type IV secretion system - BIROn - Birkbeck Institutio
... nal Research Online. . BIROn - Birkbeck Institutional Research Online. Home. About. Browse by Year. Browse by School. Browse by Person. Browse by Journal. Browse by Types. Login. Create Account. Architecture of the Helicobacter pylori Cag-type IV secretion system. Terradot, L. and Waksman, Gabriel 2011 Architecture of the Helicobacter pylori Cag-type IV secretion system. FEBS Journal 278 8, pp. 1213-22. ISSN 1742-464X. Full text not available from this repository. Official URL: http://dx.doi.org/10.1111/j.1742-4658.2011.08037.x. Abstract. Type IV secretion systems T4SS are macromolecular assemblies used by bacteria to transport material across their membranes. T4SS are generally composed of a set of twelve proteins VirB1-11 and VirD4. This represents a dynamic machine powered by three ATPases. T4SS are widespread in pathogenic bacteria where they are often used to deliver effectors into host cells. For example, the human pathogen Helicobacter pylori encodes a T4SS, the Cag-T4SS, which mediates the injec...
http://eprints.bbk.ac.uk/3357/
*  Helicobacter pylori
... Infections. Infections. Helicobacter pylori. When to Call the Doctor. Helicobacter pylori. H pylori bacteria are a common cause of digestive illnesses, including gastritis the irritation and inflammation of the stomach lining, peptic ulcers sores in the lining of the stomach, small intestine, or esophagus, and even stomach cancer later in life. pylori infection usually without any symptoms. pylori infection without knowing it most H. pylori infections are "silent" and cause no symptoms. When the bacteria do cause symptoms, they're usually either symptoms of gastritis or peptic ulcer disease. In kids, symptoms of gastritis may include nausea, vomiting, and abdominal pain, although these symptoms are seen in many childhood illnesses. H pylori, which used to be called Campylobacter pylori, also can cause peptic ulcers commonly known as stomach ulcers. Kids who have peptic ulcer disease can have ulcers that bleed, causing hematemesis bloody vomit or vomit that looks like coffee grounds or melena stool that's...
http://kidshealth.org/PageManager.jsp?dn=RenownChildrens_Hospital&lic=408&cat_id=20028&article_set=22782&ps=104
*  Helicobacter pylori
... Infections. Infections. Helicobacter pylori. Signs and Symptoms. Helicobacter pylori. H pylori bacteria are a common cause of digestive illnesses, including gastritis the irritation and inflammation of the stomach lining, peptic ulcers sores in the lining of the stomach, small intestine, or esophagus, and even stomach cancer later in life. When the bacteria do cause symptoms, they're usually either symptoms of gastritis or peptic ulcer disease. In kids, symptoms of gastritis may include nausea, vomiting, and abdominal pain, although these symptoms are seen in many childhood illnesses. H pylori, which used to be called Campylobacter pylori, also can cause peptic ulcers commonly known as stomach ulcers. Kids who have peptic ulcer disease can have ulcers that bleed, causing hematemesis bloody vomit or vomit that looks like coffee grounds or melena stool that's black, bloody, or looks like tar. Younger children with peptic ulcers may not have such clear symptoms, so their illness may be harder to diagnose. p...
http://kidshealth.org/PageManager.jsp?dn=ChildrensHealthNetwork&lic=142&cat_id=20028&article_set=22782&tracking=P_RelatedArticle
*  Genomic heterogeneity of Helicobacter pylori in gastroduodenal ulcer and the efficacy of treatment
... / May / 2007 / Theses / CNAA. CNAA Attestation committee Accreditation committee Expert committee Dispositions, instructions Normative acts. Genomic heterogeneity of Helicobacter pylori in gastroduodenal ulcer and the efficacy of treatment. Degree: doctor of medicine. Ion Ţîbîrnă doctor habilitat, professor, State University of Medicine and Pharmacy "Nicolae Testemitanu". Nicolae Barbacar doctor habilitat, professor, Institute of Genetics and Plant Physiology of the ASM. Scientific council :. pylori; CagA+, VacA+, IceA1+, BabA+ genes, endoscopic aspect, histopatologic modifications, eradication, pathogenicity iland, cytokines, duodenal ulcer, polyresistance, antibodies to H. A total of 118 patients diagnosed with duodenal ulcer H pylori positive n=54, duodenal ulcer H. pylori negative n=50 gastric ulcer H. It was revealed a positive association between CagA, VacA genes and DU. The patients infected with CagA, VacA-positive strains had a more several abdominal pain, dyspepsia, pyrozis in comparison with C...
http://cnaa.md/en/thesis/6370/
*  The helicobacter foundation Perth, Australia
... X Call Us Today. 0893464815. admin@hpylori.com.au. Toggle navigation. Toggle navigation. Home. About Foundation. Publications. Helicobacter pylori. What is Helicobacter pylori. Epidemiology. History. Animals. Famous People. Stocks. Forum. Treatment Protocol. FAQs. Contact Us. Photos. Event1. Event2. demo@companyname.com. . 0 item s - $0.00. My Account. The "Helicobacter Foundation" Team members Founded by Prof. Barry J. Marshall in early 1994, and is dedicated to providing you with the latest information about Helicobacter pylori. Helicobacter pylori Browse the website for more information. Welcome to The Helicobacter Foundation The "Helicobacter Foundation" was founded by Prof. Barry J. Marshall in early 1994, and is dedicated to providing you with the latest information about Helicobacter pylori, its diagnosis, treatment and clinical perspectives. The story of why it took 100 years to discover Helicobacter is described in these pages. ch H2 receptor antagonists for 24 hours before the breath tests are ...
http://helico.com/index.html
*  antrum
HELICOBACTER, Issue 4 2008 Arne Kandulski Abstract Background:Helicobacter pylori causes gastric inflammation. pylori infection. Seropositivity to Helicobacter pylori heat shock protein 60 is strongly associated with intensity of chronic inflammation, particularly in antrum mucosa: an extension of an 18-year follow-up study of chronic gastritis in Saaremaa, Estonia. FEMS IMMUNOLOGY & MEDICAL MICROBIOLOGY, Issue 2 2001 Tamara Vorobjova Abstract Helicobacter pylori is a cause of chronic gastritis and leads to development of atrophy in some cases. pylori in the antrum and corpus P=0.01 and is strongly correlated with the grade of chronic inflammation, particularly in the antrum mucosa r=0.34; P=0.003; OR=5.97 95% CI 1.21,29.3, but is not associated with development of atrophy during 18 years of follow-up, or with the activity of gastritis. HELICOBACTER, Issue 4 2008 Arne Kandulski Abstract Background:Helicobacter pylori causes gastric inflammation. HELICOBACTER, Issue 3 2005 Tomohiko Shimatani ABSTRACT Backgroun...
http://academicconcepts.net/concepts/50/antrum.htm
*  Helicobacter pylori eradication protocols
... 'Helicobacter pylori' eradication protocols' is a standard name for all treatment protocols for peptic ulcer s and gastritis ; the primary goal is not only temporary relief of symptom s, but also total elimination of ' Helicobacter pylori ' infection .Patients with active duodena or gastric ulcers and those with a prior ulcer history should be tested for H. 1 Antibiotic resistance Regimens for 'Helicobacter pylori' therapy First-line therapy: {{visible anchor|triple therapy}}. 2 Regimens for 'Helicobacter pylori' therapy. In areas of low clarithromycin resistance, including the United States, a 14-day course of “triple therapy, ” with an oral proton pump inhibitor, clarithromycin 500 mg, and amoxicillin 1 g or, if penicillin allergic, metronidazole 500 mg, all given twice daily for 14 days, is still recommended for first-line therapy. Bismuth-based quadruple therapy is recommended as first line therapy for patients in areas with high clarithromycin resistance > 20%, in patients who have previously been t...
https://en.wikipedia.org/wiki/Helicobacter_pylori_eradication_protocols
*  H. pylori infection Symptoms - Mayo Clinic
pylori infection Symptoms - Mayo Clinic. pylori infection. By Mayo Clinic Staff. A common cause of peptic ulcers, H. If you develop signs and symptoms of a peptic ulcer, your doctor will probably test you for H. pylori infection will never have any signs or symptoms. pylori infection, they may include:. pylori infection are related to living conditions in your childhood, such as:. People living in developing countries, where crowded and unsanitary living conditions may be more common, have a higher risk of H. pylori infection. pylori infection. pylori infection include:. Ulcers. Stomach cancer. H pylori infection is a strong risk factor for certain types of stomach cancer. pylori infection. pylori infection, some basic questions to ask your doctor include:. pylori infection include:. Breath test. Acid-suppressing drugs known as proton pump inhibitors PPIs, bismuth subsalicylate Pepto-Bismol and antibiotics can interfere with the accuracy of this test. Your doctor will ask you to stop taking those medications ...
http://mayoclinic.org/diseases-conditions/h-pylori/basics/symptoms/CON-20030903?p=1
*  Clinical and biochemical parameters related to cardiovascular disease after Helicobacter pylori erad
... ication. Document Detail. Clinical and biochemical parameters related to cardiovascular disease after Helicobacter pylori eradication. MedLine Citation:. The possible link between IHD and Helicobacter pylori H.pylori infection has been reported. In order to investigate this issue, the authors assessed changes in clinical and biochemical parameters related to IHD after bacterial eradication. H.pylori status was determined by histology or 13C-urea breath testing. Examinations for body mass index, diastolic blood pressure and blood testing C-reactive protein, fibrinogen, triglycerides, total cholesterol, high-density and low-density lipoprotein cholesterol, fasting glucose were performed before eradication and annually for up to five years thereafter. RESULTS: HDL-C increased P=0.02 while C-reactive protein and fibrinogen levels diminished P 0.0001 significantly. CONCLUSIONS: H.pylori eradication is associated with modification of some clinical and biochemical parameters related to IHD during a follow-up of ...
http://biomedsearch.com/nih/Clinical-biochemical-parameters-related-to/20087284.html
*  853 Helicobacter pylori Resistance to Antibiotics in Europe and Its Relationship to Antibiotic Consu
... mption. For full functionality of ResearchGate it is necessary to enable JavaScript. Here are the instructions how to enable JavaScript in your web browser. Article 853 Helicobacter pylori Resistance to Antibiotics in Europe and Its Relationship to Antibiotic Consumption. Francis Megraud. Francis Megraud. Remove suggestion. Samuel Coenen. Samuel Coenen University of Antwerp Message author. Remove suggestion. Ann Versporten. Ann Versporten University of Antwerp Message author. Remove suggestion. Manfred Kist. Manfred Kist. Remove suggestion. Manuel lopez-brea. Manuel lopez-brea Hospital Universitario de La Princesa Message author. Remove suggestion. Alexander M. Hirschl. Alexander M. Hirschl. Remove suggestion. London Gut. Impact Factor: 14.66. 01/2013; 62 1 :34-42. DOI: 10.1136/gutjnl-2012-302254 ABSTRACT Objective: Resistance to antibiotics is the major cause of treatment failure of Helicobacter pylori infection. A study was conducted to assess prospectively the antibacterial resistance rates of H pylori...
http://researchgate.net/publication/259737002_853_Helicobacter_pylori_Resistance_to_Antibiotics_in_Europe_and_Its_Relationship_to_Antibiotic_Consumption
*  BJBS Article :: Induction of oxidative DNA damage by Helicobacter pylori in HT29 cells
... Published for the Institute of Biomedical Science and the Academy of Clinical Science and Laboratory Medicine by Step Publishing Ltd. Home. About. Search. IBMS. Subscribe. Authors. Contact. Terms of Use. Induction of oxidative DNA damage by Helicobacter pylori in HT29 cells ORIGINAL ARTICLES: Br J Biomed Sci 2007; 64 4 ; 149-152 M Coffils *, AP Jewell, LA Jones *, MD Fielder *. * School of Life Science, Kingston University, Surrey KT1 2EE, UK Faculty of Health and Social Care Sciences, Kingston University and St George’s University of London, Surrey KT1 2EE, UK. KEY WORDS: DNA damage FLARE assay Helicobacter pylori Oxidative stress. ABSTRACT Infection with Helicobacter pylori has been associated with the development of gastric adenocarcinoma in humans. Several routes have been implicated, the main one being oxidative DNA damage resulting from chronic inflammation, which accompanies infection. However, DNA has been demonstrated in human cells after in vitro incubation with H. pylori sonicates. Using the f...
http://bjbs-online.org/article.asp?id=269
*  Helicobacter Pylori Infection | Memorial Hospital | Jacksonville, FL
Helicobacter Pylori Infection. Memorial Hospital. Jacksonville, FL. Find A Doctor. Find A Doctor Find A Doctor. Services. All Services. Ambulatory Surgery Centers. Behavioral Health Services. Cancer Care. Emergency Care. Heart & Chest Pain Center. Memorial Women's Center. NeuroSpine Center. Patients & Visitors. Patients & Visitors Patients & Visitors. Classes & Events. H2U - health to you. Medical Records. Health Info. Health Info Health Info. Health Library. Video Library. For Professionals. For Professionals For Professionals. Careers. For Employees. Hospital Affiliation Letters. Patient Transfer Center. Contact Us. Hospital Data. Hospital Information. Find A Doctor. Find A Doctor Affiliated Practices. Services. All Services. Ambulatory Surgery Centers. Behavioral Health Services. Cancer Care. Emergency Care. Heart & Chest Pain Center. Memorial Women's Center. NeuroSpine Center. Patients & Visitors. Memorial Hospital @MemorialJax Memorial has received a Gold Plus Award for Get With The Guidelines® - Stroke ...
http://memorialhospitaljax.com/hl/?/2011034102/Helicobacter-Pylori-Infection
*  Helicobacter Pylori Infection | Sunrise Hospital & Medical Center
Helicobacter Pylori Infection. Sunrise Hospital & Medical Center. Find A Doctor. Find A Doctor Find A Doctor. Hospital Affiliation Letters. Patients & Visitors. Patients & Visitors Patients & Visitors. Patient Portal. Heart Center at Sunrise. New Vision Medical Stabilization. Sunrise Children's Hospital. The Breast Center at Sunrise. Trauma Center. Mission & Vision. Nursing at Sunrise. Community Resources. Community Resources Community Resources. Consult-A-Nurse. New Vision Medical Stabilization. Social Media Disclaimer. Contact Us. ER Wait Times. Maps & Directions. Media Inquiries. Mission & Vision. Newsroom. Find A Doctor. Find A Doctor Hospital Affiliation Letters. Patients & Visitors. Patient Portal. Mission & Vision. Nursing at Sunrise. Community Resources. Community Resources AskMD. Consult-A-Nurse. New Vision Medical Stabilization. The Breast Center at Sunrise, Southern Hills Hospital and Red Rock Radiology at MountainView Hospital Offer $75 Digital Screening Mammograms The Breast Center at Sunrise, So...
http://sunrisehospital.com/hl/?/643925/Heliobacter-pylori-infection
*  Persistence of Helicobacter pylori in heterotrophic drinking-water biofilms.
... BioMedSearch. Document Detail. Persistence of Helicobacter pylori in heterotrophic drinking-water biofilms. MedLine Citation:. Although the route of transmission of Helicobacter pylori remains unknown, drinking water has been considered a possible transmission vector. It has been shown previously that, in water, biofilms are a protective niche for several pathogens, protecting them from stressful conditions, such as low carbon concentration, shear stress, and less-than-optimal temperatures. In this work, the influence of these three parameters on the persistence and cultivability of H. pylori in drinking-water biofilms was studied. Total numbers of H. pylori 16S rRNA peptide nucleic acid probe, whereas cultivable cells were assessed by standard plating onto selective H. pylori cells to incorporate, undergo morphological transformations, persist, and even agglomerate in biofilms for at least 31 days without a noticeable decrease in the total cell number on average, the concentration was between 1.54 x 10 ...
http://biomedsearch.com/nih/Persistence-Helicobacter-pylori-in-heterotrophic/18676697.html
*  .. .. Health Library .. Helicobacter Pylori .. What is Helicobacter pylori (H. pylori)? .. How doe
U of U Health Care. Find a Doctor. Services. Locations. University Hospital. Clinical Trials. U of U Health Sciences. U of U Health Care. U of U Health Sciences. Search. Search. Find a Doctor. Services. Locations. University Hospital. Clinical Trials. Health Care Home / Health Information / Related Content /. Health Library. Helicobacter Pylori. What is Helicobacter pylori H. pylori. H pylori is a spiral-shaped bacterium found in the stomach, which along with acid secretion damages stomach and duodenal tissue, causing inflammation and peptic ulcers. Approximately 30 to 40 percent of the U.S. population is thought to have H. pylori, but fortunately, most people don't develop ulcers. Even so, according to the National Institute of Diabetes and Digestive and Kidney Diseases, H. pylori is a leading cause of ulcers among those who develop them.. How does H. pylori cause damage. It is believed that H. pylori's shape and characteristics cause the damage that leads to ulcers. Because of their shape and th...
http://healthcare.utah.edu/healthlibrary/related/doc.php?type=85&id=P00373
*  Helicobacter pylori Eradication Therapies in the Era of Increasing Antibiotic Resistance: A Par
Helicobacter  pylori Eradication Therapies in the Era of Increasing Antibiotic Resistance: A Paradigm Shift to Improved Efficacy. Gastroenterology Research and Practice. About this Journal. Submit a Manuscript. Table of Contents Journal Menu. About this Journal ·. Advance Access ·. Aims and Scope ·. Annual Issues ·. Article Processing Charges ·. Author Guidelines ·. Citations to this Journal ·. Submit a Manuscript ·. Table of Contents. Open Special Issues ·. Published Special Issues ·. Special Issue Guidelines. Abstract. Full-Text PDF. Full-Text HTML. Full-Text ePUB. Full-Text XML. Citations to this Article. Complete Special Issue. Gastroenterology Research and Practice Volume 2012 2012, Article ID 757926, 9 pages http://dx.doi.org/10.1155/2012/757926. Review Article Helicobacter    pylori Eradication Therapies in the Era of Increasing Antibiotic Resistance: A Paradigm Shift to Improved Efficacy Sotirios D. Georgopoulos, 1 Vasil...
http://hindawi.com/journals/grp/2012/757926/abs/
*  Search Results
Clipboard 0. Can Helicobacter pylori infection influence human reproduction. pylori infection on human reproduction. doi:10.3748/wjg.v20.i19.5567 PMCID: PMC4024765 PMID: 24914316 Antigenic mimicry; Helicobacter pylori infection; Human sperm; Inflammatory cytokines; Preeclampsia; Reproductive disorders Related Articles. pylori infection. doi:10.1186/1471-2180-12-217 PMCID: PMC3537525 PMID: 22998649 Bacteria; Antibiotics; Chemoresistances; Polysorbate 80; Transmission electron microscopy Related Articles. doi:10.1007/s10815-008-9283-5 PMCID: PMC2649329 PMID: 19089609 Bacteria; Semen quality; Spermatozoa; TEM Related Articles. H pylori infection and systemic antibodies to CagA and heat shock protein 60 in patients with coronary heart disease. AIM: To determine the overall prevalence of H pylori and CagA positive H pylori infection and the prevalence of other bacterial and viral causes of chronic infection in patients with coronary heart disease CHD , and the potential role of anti-heat-shock protein 60 Hsp60 ant...
http://pubmedcentralcanada.ca/pmcc/solr/reg?pageSize=25&term=author:("Collodel, Giulia")&sortby=score desc&filterAuthor=author:("Figura, Natale")
*  how do you know if your ulcer is gone? - Discussion on Topix
how do you know if your ulcer is gone. - Discussion on Topix. CLOSE. ADVERTISEMENT. Helicobacter Pylori. News. Forums. Not a Topix user yet. Sign Up. Sections. All Topix Top Stories Forums User Forums. Business Tech Sports Entertainment. US News Weird News Offbeat Stars. Topix. Helicobacter Pylori. how do you know if your ulcer is gone. how do you know if your ulcer is gone. Posted in the Helicobacter Pylori Forum. Comments. 1 - 1 of 1 Comments. Last updated Jun 9, 2012. #2 Jun 9, 2012. Its a chalk like substance you drink and tastes foul and a number of xrays are done which can see the chalk and ulcers if they are present. You get a good understanding of any gastritis, damage and ulcers that exist. Reply. Report Abuse Judge it. Add your comments below. Enter Comments Characters left: 4000. Enter Username. Enter Numbers. Please note by submitting this form you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Inappropriate posts may be remove...
http://topix.com/forum/health/helicobacter-pylori/TDK9J4A53HRAD0HOU
*  Extragastrointestinal manifestations of Helicobacter pylori infection: Facts or myth? | Phoenix Risi
Phoenix Rising ME / CFS Forums. Phoenix Rising ME / CFS Forums Home. Forums. Discuss the article on the Forums. Discussion in ' Other Health News and Research ' started by nanonug , Apr 21, 2012. nanonug Senior Member. Messages:. Likes: 397. Virginia, USA. nanonug ,. Apr 21, 2012. Messages:. Likes: 189. nanonug, My ME CFS started with an ulcer that supposedly came about because of taking vioxx. Apr 21, 2012. alex3619 Senior Member. Messages:. Likes: 19,175. Apr 21, 2012. hixxy Woof woof. Messages:. Likes: 108. nanonug said:. Article: Extragastrointestinal manifestations of Helicobacter pylori infection: Facts or myth. A critical review Click to expand... hixxy ,. Apr 21, 2012. anciendaze Senior Member. Messages:. Likes: 2,195. Helicobacter pylori can be found in about half of all humans. If you read the literature on retroviral diseases in other species you will find that retroviruses often target phagocytes that defend against bacteria which are widespread or endemic in a species. Apr 21, 2012. hixxy Woof wo...
http://forums.phoenixrising.me/index.php?threads/extragastrointestinal-manifestations-of-helicobacter-pylori-infection-facts-or-myth.15784/
*  PLOS ONE: The Characterization of Helicobacter pylori DNA Associated with Ancient Human Remains Reco
... vered from a Canadian Glacier. Article-Level Metrics. Click through the PLOS taxonomy to find articles in your field. View. Sum of PLOS and PubMed Central page views and downloads. Open Access Peer-reviewed Research Article. Article. pylori DNA was amplified from the stomach tissue of the Kwäday Dän Ts'ìnchi individual. pylori DNA associated with the stomach tissue from the Kwäday Dän Ts'ìnchi individual. pylori strains and past human migration, the vacA gene sequence from the Tatshenshini H. pylori vacA m region DNA sequence and vacA m sequences from strains isolated in Okinawa, Japan. When the Tatshenshini vacA m distal sequence was compared with the vacA m region of modern strains, the sequence clustered with sequences from m1d isolates identified in North and South American Aboriginal individuals in a study by Yamaoka and colleagues on the presence of H. pylori strains, Atherton and colleagues amplified the vacA m region in 77 strains from Asia, North America and South America and identified an m1/m2 ...
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0016864
*  Virulence markers of Helicobacter pylori in patients with diarrhoea-dominant irritable bowel syndrom
... e. BioMedSearch. Home. Advanced Search. Tools. Search Tutorial. Login. Create Free Account. Document Detail. Virulence markers of Helicobacter pylori in patients with diarrhoea-dominant irritable bowel syndrome. MedLine Citation:. PMID: 22558797 Owner: NLM Status: In-Process. Abstract/OtherAbstract:. Recent studies suggest that irritable bowel syndrome IBS is associated with low-grade inflammation. This study aims to determine the distribution of Helicobacter pylori cytotoxin-associated gene A cagA and vacuolating cytotoxin A vacA alleles e.g., s1 and s2 in patients with diarrhoea-dominant IBS IBS-D as the latter causes vacuolation in colonic epithelial cells in vitro. One hundred and seventy patients meeting Rome III criteria for IBS-D mean age: 40 +/- 15 years were enrolled. Gastric biopsy was assessed histologically and DNA extraction was performed by polymerase chain reaction PCR for H. pylori genus 16S ribosomal DNA 16S rDNA, cagA and vacA allele s1 and s2. There was no age- or gender-related differe...
http://biomedsearch.com/nih/Virulence-markers-Helicobacter-pylori-in/22558797.html
*  Current Concepts And Drug Therapy Of Helicobacter Pylori Infection S. K Kulkarni, Manu Gupta - Ind
... ian J Pharm Sci. Users online: 39 Scientific Publication of the Indian Pharmaceutical Association. The Journal. Search. Current Issue. Archives. Instructions. Online submission. Login. Year : 1999. Volume : 61. Issue : 6. Page : 323-334. Current Concepts And Drug Therapy Of Helicobacter Pylori Infection S. K Kulkarni, Manu Gupta,. Correspondence Address : S. K Kulkarni. Source of Support: None, Conflict of Interest: None. Helicobacter pylori first identified in 1906 in the human gastric mucosa has now been established in the etiology of belching, indigestion, chronic superficial gastritis, chronic peptic ulceration, adenocarcinoma of stomach, primacy gastric non-Hodgkins lymphoma, low grade B cell mucosa associated lymphoid tissue lymphoma MALT lymphoma. This article discusses the current concepts about the involvement of the bacteria including the pathophysiology and drug therapy for the infection. * Next article. Previous article. Table of Contents. Similar in PUBMED. Search Pubmed for. Kulkarni S. Gupt...
http://ijpsonline.com/article.asp?issn=0250-474X;year=1999;volume=61;issue=6;spage=323;epage=334;aulast=Kulkarni;type=0
*  Gastric ulcer bacteria turn immune defense inwards
... bacteria , gastric , Helicobacter , immune , pylori , ulcer. Despite a strong response from our immune defence, the body is unable to rid itself of the bacterium Helicobacter pylori. One reason for this is that this bacterium encourages elements of the immune response to remain in tissue, activating the wrong immune cells. The majority never show any symptoms, but just over ten per cent develop gastric ulcers, while around one per cent develop gastric adenocarcinoma. "Helicobacter pylori inhibits our immune defence, preventing it from attacking the bacteria with sufficient strength, despite an immune response being activated," says biologist Malin Hansson, the author of the thesis. "Helicobacter pylori causes immune cells to accumulate in tissue. Many of the cells that ought to collect more new immune cells stop at these accumulations and begin activating these instead, leading to chronic inflammation, which we believe benefits Helicobacter pylori," says Malin Hansson. Previous research has shown that ma...
http://microbeworld.org/component/jlibrary/?view=article&id=2575
*  World J Gastroenterol
Does Helicobacter pylori eradication therapy for peptic ulcer prevent gastric cancer. eradication therapy for peptic ulcer patients with a mean age of 52.9 years at registration did not significantly decrease the incidence of gastric cancer. ; Peptic ulcer; Gastric cancer; Eradication therapy; Cancer prevention. Does Helicobacter pylori eradication therapy for peptic ulcer prevent gastric cancer. During a total of 22 900 person-years of follow-up mean follow-up period: 5.6 years, gastric cancer was found in 56 patients, including 47/3781 patients 1.24%, 0.21%/year who received H pylori eradication therapy and 9/352 patients 2.56%, 0.50%/year who received conventional antacid therapy. Analysis by type of peptic ulcer at the time of registration revealed that the incidence of gastric cancer did not differ between patients with and without successful eradication in subgroups of patients with gastric or gastroduodenal ulcer, while successful eradication decreased the incidence of gastric cancer significantly in p...
http://wjgnet.com/1007-9327/15/4290.asp
*  Helicobacter pylori infection
... redirect helicobacter pylori...
https://en.wikipedia.org/wiki/Helicobacter_pylori_infection
*  Health Information LibraryHelicobacter Pylori Bacteria
health information library skip navigation display mode choose default style choose high contrast search healthwise search back to healthwise home main content health information helicobacter pylori bacteria helicobacter pylori bacteria skip to the navigation helicobacter pylori is a type of bacteria that is a major cause of stomach gastric and upper small intestine duodenal ulcers infection with h pylori may also increase the risk of stomach cancer h pylori bacteria can cause ulcers by growing in the lining of the stomach producing inflammation and causing the stomach and intestinal lining to be more easily damaged by stomach acid but most people infected with h pylori do not develop ulcers an additional factor such as stress one that cannot always be identified may be needed to cause an ulcer to form h pylori bacteria can be eliminated by taking certain antibiotics that are specifically directed at this bacteria current as of november author healthwise staff medical review e gregory thompson md internal med...
http://sutterhealth.org/healthwise/index.php?A=C&hwid=sth149592
*  High seroprevalence ofHelicobacter pylori in diabetes mellitus patients - Springer
... Find out how to access preview-only content. High seroprevalence of Helicobacter pylori in diabetes mellitus patients. Affiliated with From the Department of Internal Medicine and Laboratory for Public Health, Diakonessen Hospital. Affiliated with From the Department of Internal Medicine and Laboratory for Public Health, Diakonessen Hospital. Affiliated with From the Department of Internal Medicine and Laboratory for Public Health, Diakonessen Hospital. pylori in patients with diabetes mellitus. Within six months, 45 insulin-dependent, 98 non-insulin-dependent, and a control group of 159 outpatients were enrolled in this study. The age adjusted seroprevalence rates of Helicobacter pylori were determined using a commercial anti- Helicobacter pylori IgG and IgA ELISA Bio-Rad. Address for reprint requests: University Hospital Utrecht, Department of Gastroenterology, Room F2.618, PO Box 85500, 3508 GA Utrecht, The Netherlands. Share Share this content on Facebook Share this content on Twitter Share this cont...
http://link.springer.com/article/10.1007/BF02282318
*  Eat Right For Your Type: The Individualist: Diet, Helicobacter pylori, and p53 mutations in gastric
... cancer. A molecular epidemiology study in Italy. Blood Type and Nutrition. Social Media. What's Your Type. Blood Type A. Blood Type B. Blood Type O. Blood Type AB. The GenoType Diet. Print Media. Blood Groups and Disease. Right For Your Type. Secretor Status Kit. Blood Type Formulas. GenoType Formulas. Diet, Helicobacter pylori, and p53 mutations in gastric cancer. A molecular epidemiology study in Italy. Blood Groups and Anthropology. Disease and Blood Groups. References Diet, Helicobacter pylori, and p53 mutations in gastric cancer: a molecular epidemiology study in Italy Cancer Epidemiol Biomarkers Prev. A series of 105 gastric cancer GC cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. No re...
http://drpeterjdadamo.com/wiki/wiki.pl/Diet,_Helicobacter_pylori,_and_p53_mutations_in_gastric_cancer._A_molecular_epidemiology_study_in_Italy
*  RE: Helicobacter Pylori Stains
re helicobacter pylori stains re helicobacter pylori stains from tom t mcnemar tmcnemar lmhealth org we recently switched from the warthin starry stain to immuno the warthin starry was a quick stain but it gave inconsistent results and had to be watched pretty closely i much prefer as do the pathologists the immuno yes it takes longer and costs a little more on the surface but when you figure in the time and reagents involved in the frequent repeats i think it balances out pretty well we used to batch the warthin starry and do it only twice a week with immuno we are able to do them daily so the reporting is better the immuno is consistently very good with intense staining we are using dako concentrated ab with dako target retrieval in the steamer for minutes tom mc nemar ht ascp pathology supervisor licking memorial hospital newark ohio original message from richard maliniak sent monday october pm to histonet server subject helicobacter pylori stains we currently use the genta stain for h pylori we are not sa...
http://histosearch.com/histonet/Oct00/RE.HelicobacterPyloriStai.html
*  Helicobacter Pylori Breath Test - Questions & Answers - Wellsphere
helicobacter pylori breath test questions answers wellsphere health knowledge made personal home communities wellpages welltools my wellsphere log in helicobacter pylori breath test bookmark share main articles discussions pictures more people resources tips videos please enter a search word or phrase close the search word cannot have more than characteres close questions answers general discussions go search q a helicobacter pylori breath test questions answers sort by newest most answers relevance ask a question no questions were found for helicobacter pylori breath test try again using a different search word or phrase wellsphere about us contact us faq video health stories privacy policy terms of use security policy advertise with us wellpages a b c d e f g h i j k l m n o p q r s t u v w x y z see all the latest blog posts salmonella nutrition bars children staph infection how to reduce ldl life expectancy emphysema itchy swollen eyelids fibromyalgia disability bone density medications causes of swelling...
http://wellsphere.com/questions/helicobacter-pylori-breath-test
*  RE: Helicobacter pylori
... From: Robin Thain. Here is a method for Alcian Yellow formalin fixed tissue 1. 1% periodic acid 2. 5% sodium metabisulphite 3. 1% Alcian Yellow 1 gram Alcian Yellow in 100ml of 50% ethanol; add 3ml of glacial acetic acid *filter before use 4. Toludine Blue Stock Solution 1 gram tol. blue and 100ml of distilled water DW 5. Toludine Blue working solution 0.5ml of Tol blue stock with 50ml of DW and add 2 drops of 3% sodium hydroxide **solutions 1 and 5 should be made fresh each time 1. dewax and dehydrate sections 2. oxidize in periodic acid for 10 min. 3 wash well in tap water 4. treat with 5% sodium metabisulphite for 5 min. 5 wash for 2 min. in tap water 6. stain with Alcian yellow for 5 min. 7 wash well again 8. stain in toludine blue working solution for 3 min. 9 wash well in tap water 10. blot dry 11. clear and mount Helicobacter pylori blue mucin yellow background pale blue The literature reads that this stain is useful as a screening tool. -----Original Message----- From: Mary Reeves Sent: July 25, ...
http://histosearch.com/histonet/Jul02A/RE.HelicobacterpyloriH.html
*  Stool Test: H. Pylori Antigen
... KidsHealth from Nemours. Doctors & Hospitals. Visit KidsHealth in the Classroom. Stool Test: H. Pylori Antigen. KidsHealth. Doctors & Hospitals. Medical Tests & Exams Stool Test: H. Pylori Antigen Print. Risks. If You Have Questions. What It Is Helicobacter pylori H. pylori bacteria are a common cause of peptic ulcers sores in the lining of the stomach, small intestine, or esophagus. pylori antigens are present in your child's gastrointestinal GI system. pylori antigen stool test if your child has symptoms that could indicate the presence of a peptic ulcer, such as indigestion, abdominal pain, a full or bloated feeling, nausea, frequent belching, or vomiting. Preparation Unlike most other lab tests, a stool sample is often collected by parents at home, not by health care professionals at a hospital or clinic. Procedure The doctor or hospital laboratory usually will provide written instructions on how to collect a stool sample. If instructions aren't provided, here are tips for collecting a stool sample f...
http://kidshealth.org/parent/system/medical/test_pylori_antigen.html?tracking=P_RelatedArticle
*  Browsing by Author "Boer, W.A. de"
... Radboud Repository. Radboud Repository → Browsing by Author. Browsing by Author "Boer, W.A. de". Or type in a year:. Now showing items 1-15 of 15. ; Boer, W.A. van ; Jacobs, J.Y.H.A. Seven-day PPI-triple therapy with levofloxacin is very effective for Helicobacter pylori eradication. Janssen, M.J.R. ; Boer, W.A. de. 2009, Article / Letter to editor Netherlands Journal of Medicine, vol. 67, iss. van ;. Laheij, R.J.F. ; Boer, W.A. de ; Hazel, S Van den ; Tan, A.C. Jansen, J.B.M.J. 2008, Article / Letter to editor Clinical Gastroenterology and Hepatology, vol. 6, iss. ; Boer, W.A. de ;. 2007, Article / Letter to editor Fuel, vol. 86, iss. Janssen, M.J.R. ; Boer, S.Y. ; Boer, W.A. de ;. Laheij, R.J.F. Jansen, J.B.M.J. 2006, Article / Letter to editor Netherlands Journal of Medicine, vol. 64, iss. Meta-analysis: the influence of pre-treatment with a proton pump inhibitor on Helicobacter pylori eradication. Janssen, M.J.R. Laheij, R.J.F. ; Boer, W.A. de ;. Jansen, J.B.M.J. 2005, Article / Letter to editor Alim...
http://repository.ubn.ru.nl/browse?type=author&value=Boer, W.A. de&value_lang=en_US
*  Helicobacter pylori
... mcgeed at HAL.HAHNEMANN.EDU mcgeed at HAL.HAHNEMANN.EDU. Wed Mar 22 09:59:59 EST 1995. Previous message: Junk Genes Next message: Absorb Some Knowledge of Water Messages sorted by:. On Wed, 22 Mar 1995, Bryan Kiehl wrote: I work in a development diagnostic company and am thinking about developing a helicobacter test. I understand that there are many test, but would like to develop one measuring antibodies against specific proteins. To do this, I would need either affinity purified, recombinant, or peptide proteins. These should be specific to the species. Anyone have suggestions. Dear Bryan, Although the urease genes have been well characterized from H. pylori, they are found in other bacteria, including enteric bugs. There is a sialic acid binding protein called HpaA that appears to be unique to the species, although other bacteria have sialic acid-binding proteins. The most recent reference for HpaA is Evans, et al. Cloning, Nucleotide Sequence, and Expression of a Gene Encoding an Adhesin Subunit Prot...
http://bio.net/bionet/mm/microbio/1995-March/001733.html
*  Gastric lymphoma in an 11-year-old boy: a case report.
... BioMedSearch. Search Tutorial. Create Free Account. Document Detail. Gastric lymphoma in an 11-year-old boy: a case report. MedLine Citation:. PMID: 8232084 Owner: NLM Status: MEDLINE. Abstract/OtherAbstract:. A child with prolonged abdominal symptoms was shown to have a concomitant gastric non-Hodgkin lymphoma and gastritis caused by Helicobacter pylori infection. After a course of antibiotics and 6 months of chemotherapy, the patient is disease free. The relationship of the microbial infection and tumor development is discussed. The case supports a hypothesis that local H. pylori infection may be a predisposing factor for gastric lymphoma. Authors:. Related Documents :. 18200634 - Il-23-mediated regulation of il-17 production in helicobacter pylori-infected gastric m... 17710564 - Helicobacter pylori infection can change the intensity of gastric lewis antigen express... 10363194 - Helicobacter pylori increases the risk of peptic ulcer bleeding: a case-control study. 6387604 - Opportunistic fungal infec...
http://biomedsearch.com/nih/Gastric-lymphoma-in-11-year/8232084.html
*  Is Helicobacter pylori the Infectious Trigger for Headache?: A Review
... Browse Journals. Bentham Online. Contact. By Titles By Subject Browse Patent Journals Price and Ordering Information New Journals New Journals 2016 New Journals 2015 New Journals 2014. Subscription Rates Subscription Rates 2015 Subscription Rates 2014. Journals Impacting Science Free Online Samples Journal Catalogs Endorsements. Submit Manuscripts Purchase Articles Search Articles Online Feedback Social Media Bentham Insight. Editorial Policies Publishing Ethics Self-Archiving Policies Reviewer Guidelines Author Benefits. ISSN: 2212-3989 Online ISSN: 1871-5265 Print. Volume 15, 3 Issues, 2015. Infectious Disorders - Drug Targets. Formerly: Current Drug Targets - Infectious Disorders. Submit Abstracts Online. Purchase Articles. Editorial Policies. Publishing Ethics. Self-Archiving Policies. Reviewer Guidelines. Instructions for Authors. Free Copies Online. Is Helicobacter pylori the Infectious Trigger for Headache?: A Review. Infectious Disorders - Drug Targets,. pylori and headache. To identify all publi...
http://benthamscience.com/journal/abstracts.php?journalID=iddt&articleID=118497
*  Health Information LibraryH. Pylori Gastritis as Seen During Endoscopy
Health Information Library. Skip Navigation Display Mode: Choose Default Style. Choose High Contrast. Search Healthwise. Search. < Back to Healthwise Home. Main content Health Information H. Pylori Gastritis as Seen During Endoscopy. H Pylori Gastritis as Seen During Endoscopy Skip to the navigation. Gastritis is inflammation or irritation of the stomach lining. It can be caused by some medicines such as aspirin or other anti-inflammatory medicines, overuse of alcohol, stomach acid, or bacterial infection. An infection with the bacteria Helicobacter pylori H. pylori can cause gastritis. H pylori is also the bacteria that causes ulcers. One way to test for H. pylori is to take a tissue sample from the stomach. The doctor uses a thin, flexible, lighted viewing instrument endoscope to look down your throat and into your stomach. Looking through the endoscope, your doctor may also see irritation or inflammation in the lining of your stomach. This irritation is gastritis. And a tissue sample will tell the doctor i...
http://sutterhealth.org/healthwise/index.php?A=C&hwid=zm2580
*  KEGG GENOME: Helicobacter pylori PeCan18
kegg genome helicobacter pylori pecan genome helicobacter pylori pecan entry t complete genome name hca definition helicobacter pylori pecan annotation koala taxonomy tax lineage bacteria proteobacteria epsilonproteobacteria campylobacterales helicobacteraceae helicobacter data source refseq assembly gca original db washington u chromosome circular sequence rs nc gb cp length statistics number of nucleotides number of protein genes number of rna genes all links ontology kegg brite pathway kegg module genome assembly gene kegg genes kegg mgenes refgene dna sequence refseq nuc genbank taxonomy tax all databases download rdf dbget integrated database retrieval system...
http://genome.jp/dbget-bin/www_bget?gn:T02036
*  Study: H. pylori may be linked to diabetes risk
study h pylori may be linked to diabetes risk click to print email this close study h pylori may be linked to diabetes risk by allison cerra new york a bacterium found in the stomach may be associated with diabetes according to a study published in the journal of infectious diseases using data from two national health and nutrition examination surveys researchers yu chen and martin glaser of the new york university school of medicine conducted a cross sectional analyses of participants from nhanes iii ages years and older and participants in nhanes ages years and older to assess the association between helicobacter pylori and hba c levels the researchers found that while there was no association between h pylori and history of self reported diabetes they did find that data expected associations of demographic and lifestyle factors with hba c and h pylori status and suggest a relationship between h pylori and noting the association was strongest among obese people the findings indicated a role of h pylori in i...
http://drugstorenews.com/print/467906
*  Effects of Helicobacter pylori γ-Glutamyltranspeptidase on Apoptosis and Inflammation in Human Bili
... ary Cells. BioMedSearch. Document Detail. Effects of Helicobacter pylori γ-Glutamyltranspeptidase on Apoptosis and Inflammation in Human Biliary Cells. MedLine Citation:. pylori in individuals with hepatobiliary diseases, but in vitro and in vivo studies are still needed. pylori γ-glutamyltranspeptidase GGT on the induction of apoptosis and IL-8 production in a human cholangiocarcinoma cell line KKU-100 cells. RT-PCR and western blot analysis were performed to assess gene and protein expression, respectively. IL-8 secretion in KKU-100 cells was measured by ELISA. pylori ggt + strain decreased KKU-100 cell survival and DNA synthesis when compared with cells exposed to the H. pylori ggt mutant strain. pylori GGT rHP-GGT dramatically decreased cell survival and DNA synthesis, and stimulated apoptosis; these features corresponded to an increased level of iNOS gene expression in KKU-100 cells treated with rHP-GGT. RT-PCR and western blot analyses revealed that rHP-GGT treatment enhanced the expression of pro-a...
http://biomedsearch.com/nih/Effects-Helicobacter-pylori-Glutamyltranspeptidase-Apoptosis/22581342.html
*  S Honda
... add edit you are here scientific experts japan oita medical university honda s honda research topics metaplasia stomach ulcer gastric mucosa gerbillinae monocytes neutrophils helicobacter infections helicobacter pylori body weight stomach neoplasms animal disease models carcinogens s honda summary affiliation oita medical university country japan publications development of helicobacter pylori induced gastric carcinoma in mongolian gerbils s honda second department of internal medicine oita medical university japan cancer res helicobacter pylori infection and gastric carcinoma in animal models t fujioka second department of internal medicine oita medical university japan j gastroenterol hepatol d collaborators t fujioka m tokieda detail information publications development of helicobacter pylori induced gastric carcinoma in mongolian gerbils s honda second department of internal medicine oita medical university japan cancer res the uninfected control animals showed no abnormal findings throughout the ent...
http://labome.org/expert/japan/oita/honda/s-honda-778365.html
*  Untitled Document
Innate immune response to Helicobacter pylor i:. Toll like receptor recognition: Cells of the innate immune system- macrophages, nuetrophils, etc.- recognize and respond to pathogens by the use of Toll like receptors TLR. Toll like receptors are cell surface receptors that recognize and are stimulated by microbe associated molecular patterns. For example, TLR4 recognizes lipopolysaccharide LPS from most Gram-negative bacteria Helicobacter pylori is a gram-negative bacteria. When the TLR recognize LPS, a signaling cascade is started that leads to the activation of NF- B. In summary, stimulated Toll like receptors activate a cascade that starts the innate immune response and alerts the adaptive immune response. The Toll like receptors stimulation in Helicobacter pylori is complex. H pylori are Gram-negative bacteria that have LPS. pylori LPS does not stimulate TLR4 in human gastric epithelial cells where H. pylori LPS is not a TLR4 agonist, the LPS does stimulate TLR2 which is unusual for a Gram-negative bacter...
http://bio.davidson.edu/people/sosarafova/Assets/Bio307/vinardone/page02.html
*  Stomach bacterium damages human DNA
... September 6, 2011 Stomach bacterium damages human DNA September 6, 2011 The stomach bacterium Helicobacter pylori is one of the biggest risk factors for the development of gastric cancer, the third most common cause of cancer-related deaths in the world. Molecular biologists from the University of Zurich have now identified a mechanism of Helicobacter pylori that damages the DNA of cells in the gastric mucosa and sets them up for malignant transformation. Gastric cancer is one of the most common and often fatal cancers: Every third cancer death is due to gastric carcinoma. The main risk factor for the development of gastric cancer is the chronic infection of the gastric mucosa with the bacterium Helicobacter pylori. Massimo Lopes from the Institute of Molecular Cancer Research at the University of Zurich have demonstrated how Helicobacter pylori harms human and animal host cells in in vitro experiments. The study published in the science journal PNAS shows that infection of host cells leads to breaks in ...
http://medicalxpress.com/news/2011-09-stomach-bacterium-human-dna.html
*  GastroHep News Story
pylori isolated in China. A study in this month's issue of Helicobacter investigates antibiotic resistance of Helicobacter pylori isolated in the southeast coastal region of China. The resistance of Helicobacter pylori to antibiotics is increasing worldwide, lowering its efficacy in current eradication therapies. Dr Peng Su and colleagues from China evaluated Helicobacter pylori resistance to antibiotics in the southeast coastal region of China. The team collected 17,731 Helicobacter pylori strains from 8 areas of 2 provinces in coastal southeast China from 2010 to 2012. The doctors found that the resistance rates to clarithromycin, metronidazole, levofloxacin, amoxicillin, gentamicin and furazolidone were 22%, 95%, 21%, 0.1%, 0.1%, and 0.1%, respectively. Helicobacter. The research team found a positive association between the resistance to levofloxacin and to clarithromycin but there was a negative correlation in the resistances to levofloxacin and to metronidazole. Dr Su's team commented, "The prevalence o...
http://gastrohep.com/news/news.asp?id=109718
*  CagA
... helicobacter pylori virulence factor caga cytotoxin associated gene a is a kda protein encoded on the kb cag pathogenicity island pai h pylori strains can be divided into caga positive or negative strains around of h pylori isolates in western countries are positive whereas the majority of east asian isolates are positive the cag pai also encodes for a type secretion system which is used to inject caga into a target cell upon h pylori attachment after translocation caga localises to the inner surface of the cell membrane and undergoes tyrosine phosphorylation by src family kinase s e g fyn and lyn role in cancer h pylori infection is associated with malt lymphoma and gastric adenocarcinoma and caga is thought to be involved in cancer development phosphorylated caga is able to interact with the shp tyrosine phosphatase rendering it functionally active triggering a host cell morphological change to a more motile phenotype known as the hummingbird phenotype this phenotype mimics an effect produced by hepato...
https://en.wikipedia.org/wiki/CagA
*  Stool Test: H. Pylori Antigen - KidsHealth For Parents : Akron Children's Hospital
... . Parents Teens Kids En Espa ol. Para Padres Para Adolescentes Para Ni os In English. Stool Test: H. Pylori Antigen. What It Is Helicobacter pylori H. pylori bacteria are a common cause of peptic ulcers sores in the lining of the stomach, small intestine, or esophagus. In this test, a stool feces sample is used to determine if H. pylori antigens are present in your child's gastrointestinal GI system. Antigens are substances that trigger the immune system to fight infection. Why It's Done A doctor may request an H. pylori antigen stool test if your child has symptoms that could indicate the presence of a peptic ulcer, such as indigestion, abdominal pain, a full or bloated feeling, nausea, frequent belching, or vomiting. A test also might be ordered after your child completes a course of antibiotics for H. pylori to determine whether it eradicated the infection. Preparation Unlike most other lab tests, a stool sample is often collected by parents at home, not by health care professionals at a hospital or c...
https://akronchildrens.org/cms/kidshealth/36f370b889b0208d/index.html
*  (IUCr) Crystallography Journals Online - supporting information
IUCr Crystallography Journals Online - supporting information. Acta Crystallographica Section D Biological Crystallography Volume 69, Part 8 August 2013 research papers. Acta Cryst. Protein HP1028 from the human pathogen Helicobacter pylori belongs to the lipocalin family N. Barison , L. Cendron , V. Loconte , E. A Proctor , N. V Dokholyan and G. Zanotti Abstract: Helicobacter pylori is a bacterial pathogen that causes severe diseases, including gastritis, ulcers and gastric cancer. Although this bacterium has been extensively studied, the physiological functions of a large number of the proteins encoded by its genome are unknown. HP1028 is a protein that is relevant to colonization and to the survival of the bacterium in the stomach, but its function is not clearly understood. Bioinformatics studies suggest that HP1028 is a monomeric protein that is secreted in the H. pylori periplasm. The crystal structure of HP1028 has been determined at 2.6 resolution using the SAD method. The three-dimensional structure ...
http://journals.iucr.org/d/issues/2013/08/00/gm5022/stdsup.html
*  polA - DNA polymerase I - Helicobacter pylori (strain ATCC 700392 / 26695)
polA - DNA polymerase I - Helicobacter pylori strain ATCC 700392 / 26695. p>An evidence describes the source of an annotation, e.g. an experiment that has been published in the scientific literature, an orthologous protein, a record from another database, etc. /p> p> a href="/manual/evidences">More… /a> /p>. Skip Header. UniProtKB. x UniProtKB Protein knowledgebase UniParc Sequence archive Help Help pages, FAQs, UniProtKB manual, documents, news archive and Biocuration projects. UniRef Sequence clusters Proteomes Protein sets from fully sequenced genomes Annotation systems Systems used to automatically annotate proteins with high accuracy: UniRule Manually curated rules. SAAS System generated rules. Supporting data Select one of the options below to target your search: Literature citations. Taxonomy. Keywords. Subcellular locations. Cross-referenced databases. Human diseases. Advanced Search. x Searching in. Home. BLAST. Align. Retrieve/ID mapping. Contact. Help. You are using a version...
http://uniprot.org/uniprot/P56105
*  leuS - Leucine--tRNA ligase - Helicobacter pylori (strain ATCC 700392 / 26695)
leuS - Leucine--tRNA ligase - Helicobacter pylori strain ATCC 700392 / 26695. p>An evidence describes the source of an annotation, e.g. an experiment that has been published in the scientific literature, an orthologous protein, a record from another database, etc. /p> p> a href="/manual/evidences">More… /a> /p>. Skip Header. UniProtKB. x UniProtKB Protein knowledgebase UniParc Sequence archive Help Help pages, FAQs, UniProtKB manual, documents, news archive and Biocuration projects. UniRef Sequence clusters Proteomes Protein sets from fully sequenced genomes Annotation systems Systems used to automatically annotate proteins with high accuracy: UniRule Manually curated rules. SAAS System generated rules. Supporting data Select one of the options below to target your search: Literature citations. Taxonomy. Keywords. Subcellular locations. Cross-referenced databases. Human diseases. Advanced Search. x Searching in. Home. BLAST. Align. Retrieve/ID mapping. Contact. Help. You are using a ver...
http://uniprot.org/uniprot/P56457
*  Is H. Pylori the Cause of Your Tummy Troubles? - News - Stuttgart Daily Leader - Stuttgart, AR - St
Pylori the Cause of Your Tummy Troubles. - News - Stuttgart Daily Leader - Stuttgart, AR - Stuttgart, AR. Pylori the Cause of Your Tummy Troubles. pylori can be the culprit behind everything from stomach ulcers to bloating, burping and nausea. Stuttgart Daily Leader - Stuttgart, AR. Posted Feb. 23, 2013 at 12:01 AM Updated Feb 23, 2013 at 10:23 PM. Posted Feb. You could be infected with a microscopic spiral-shaped bacterium called Heliobacter pylori, or H. pylori, which can cause a stomach pain along with bloating, burping and loss of appetite; ongoing discomfort in your upper abdomen; or nausea and vomiting. pylori burrows into the protective mucus lining the stomach and duodenum. If the ulcer worsens, a person may develop intense stomach pain or bloody or black stools. H pylori may also cause gastritis and dyspepsia, which trigger ulcer-like symptoms. Symptoms include pain in the upper abdomen, nausea and vomiting and loss of appetite. Dyspepsia is described as chronic or recurrent pain or discomfort in the...
http://stuttgartdailyleader.com/article/20130223/NEWS/302239961/1637/helena-arkansas.com
*  Helicobacter pylori
... Name = 'Helicobacter pylori'. Inflammation, gastritis, and ulcer. Up to 85% of people infected with 'H. pylori' have a 10 to 20% lifetime risk of developing peptic ulcers and a 1 to 2% risk of acquiring stomach cancer. Inflammation of the pyloric antrum is more likely to lead to duodenal ulcers, while inflammation of the corpus body of the stomach is more likely to lead to gastric ulcers and gastric carcinoma. Bacterial strains with the 'cagA' gene are associated with an ability to cause ulcer s. pylori' can result in chronic gastritis, an inflammation of the stomach lining, at the site of infection. 'Helicobacter' cysteine-rich proteins Hcp, particularly HcpA hp0211, are known to trigger an immune response, causing inflammation. Western people infected with strains carrying the 'cag' PAI have a stronger inflammatory response in the stomach and are at a greater risk of developing peptic ulcers or stomach cancer than those infected with strains lacking the island. pylori' is associated with altered signal...
https://en.wikipedia.org/wiki/Helicobacter_pylori
*  H. pylori treatment
H pylori treatment. Home. Contact Us. About Us. Disclaimer. Privacy Statement. FAQ's. Breaking News. All About Matula. H pylori Treatment. Candida Treatment. Proven H pylori treatment revealed - Overcoming H. pylori without negative effects - In mainstream medicine, the choice of treatment is currently very limited. Your doctor really has only 2 options, both of which have many negative side effects, and with failure rates as high as 70% being reported. So what is this new proven treatment that everyone is talking about. Our Natural Health team reveal the secrets of a super-successful treatment method now being used by health care professionals around the world... Full Story Below. Matula Herbal Formula Links:: Proven Treatment Methods Order Matula Herbal Formula for H. pylori Now The History of Matula Herbal Formula All About Matula Herbal Formula 100% Money-Back Guarantee Endorsement - Professor Patrick Bouic Patient Testimonials FAQ's about H. pylori infections and treatments. Where am I :: Home / h-pylori...
http://super-natural-herbs.com/h-pylori-treatment.shtml
*  Gastritis - JFK Medical Center | Atlantis, FL
Gastritis - JFK Medical Center. Aventura Hospital & Medical Center. University Hospital & Medical Center. Services Medical Services A-Z. Breast Care. At JFK Medical Center, we treat the most important health concerns - yours. H2U - health to you. Patient Rights and Responsibilities and Patient Visitation Rights. Health Info Health Library. Our health library gives you the information you need to take charge of your health. Health Library. Our health library gives you the information you need to take charge of your health. The treatments mentioned below have merely shown some promise in preliminary studies. pylori on its own, preliminary studies one of which was double-blind 5 suggest that probiotics may help standard antibiotic therapy work better, improving the rate of eradication and reducing side effects. 18-20 Other natural supplements that have shown promise for protecting against the side effects of these drugs include the amino acid cysteine,. If you suffer from stomach discomfort but your doctor does ...
http://jfkmc.com/your-health/?/38392/gastritis
*  Dysregulation of stem cell signaling network due to germline mutation, SNP, Helicobacter pylori infe
dysregulation of stem cell signaling network due to germline mutation snp helicobacter pylori infection epigenetic change and genetic alteration in gastric cancer alzforum jump to the navigation menu login to my alzforum jump to the search form paper tools email share how would you like to share facebook twitter linkedin back to the top katoh m dysregulation of stem cell signaling network due to germline mutation snp helicobacter pylori infection epigenetic change and genetic alteration in gastric cancer cancer biol ther jun pubmed recommends please login to recommend the paper comments comments on this paper no available comments make a comment to make a comment you must login or register enter your keywords login home about us newsletter news all news conference coverage webinars all webinars databases alzbiomarker alzpedia alzrisk antibodies brain banks genetics alzgene hex mutations protocols research models therapeutics papers all papers papers of the week milestone alzforum recommends professional resou...
http://alzforum.org/papers/dysregulation-stem-cell-signaling-network-due-germline-mutation-snp-helicobacter-pylori
*  lpxA - Acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase - Helicobacter pylori
lpxA - Acyl- --UDP-N-acetylglucosamine O-acyltransferase - Helicobacter pylori strain Shi470. p>An evidence describes the source of an annotation, e.g. an experiment that has been published in the scientific literature, an orthologous protein, a record from another database, etc. /p> p> a href="/manual/evidences">More… /a> /p>. Skip Header. UniProtKB. x UniProtKB Protein knowledgebase UniParc Sequence archive Help Help pages, FAQs, UniProtKB manual, documents, news archive and Biocuration projects. UniRef Sequence clusters Proteomes Protein sets from fully sequenced genomes Annotation systems Systems used to automatically annotate proteins with high accuracy: UniRule Manually curated rules. SAAS System generated rules. Supporting data Select one of the options below to target your search: Literature citations. Taxonomy. Keywords. Subcellular locations. Cross-referenced databases. Human diseases. Advanced Search. x Searching in. Home. BLAST. Align. Retrieve/ID mapping. Contact. Help. You...
http://uniprot.org/uniprot/B2UVD9
*  Tips From Other Journals - American Family Physician
pylori Infection. All others: Purchase online access. Purchase online access to read the full version of this article. Serum IgG antibody tests for Helicobacter pylori remain positive months after treatment. Currently, paired serologies can be used to determine cure, or a patient can undergo urea breath tests or gastric biopsy. pylori infection more than one year after treatment. pylori serum antibody tests were positive in each patient, as were gastric biopsies. Each patient was then treated with a two-week course of 524 mg of bismuth subsalicylate four times daily, 500 mg of tetracycline four times daily and 250 mg of metronidazole four times daily. Serum antibodies were retested, and mucosal biopsies of the gastric body were performed one, three and 18 months after completion of therapy. Biopsies of the gastric antrum were performed at three and 18 months. pylori organisms on both gastric biopsies at 18 months. H pylori infection was cured in 65 percent of the patients in the study approximately 18 months ...
http://aafp.org/afp/1998/1201/p2143.html
*  Frau Dr. rer. nat. Monika Reuter: Die Restriktionsendonuklease EcoRII: Primitives antivir
... ales Abwehrsystem der Bakterien oder mehr. Eine Struktur-Funktions-Analyse des Enzyms. Frau Dr. rer. nat. Monika Reuter: Die Restriktionsendonuklease Eco RII: Primitives antivirales Abwehrsystem der Bakterien oder mehr. Eine Struktur-Funktions-Analyse des Enzyms. Kapitel: 1. 2 3 Seite: 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 40 41 42 43 44 45 46 47 48 49. Fremdzitate Alm, R.A., Ling, L.S., Moir, D.T., King, B.L., Brown, E.D., Doig, P.C., Smith, D.R., Noonan, B.,Guild, B.C., de Jonge, B.L. et al. 1999 Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 397, 176-180 Ando, T., Xu, Q., Torres, M., Kusugami, K., Israel, D.A. and Blaser, M.J. 2000 Restriction-modification system differences in Helicobacter pylori are a barrier to interstrain plasmid transfer. Mol. Microbiol. 37, 1052-1065 Arber, W. and Dussoix, D. 1962 Host specificity of DNA produced by Escherichia coli. I Host-controlled mod...
http://edoc.hu-berlin.de/habilitationen/reuter-monika-2002-11-05/HTML/N10A93.html
*  H. Pylori Eradication Might Reduce Recurrent Gastric Cancer After Surgery - NEJM Journal Watch
. H Pylori Eradication Might Reduce Recurrent Gastric Cancer After Surgery - NEJM Journal Watch. Skip to main content. Subscribe. Renew. Create Account. Sign In. Subscribe. Renew. Create Account. Sign In. NEJM Journal Watch. Menu. Settings. Search. Main menu Home. Specialties Topics Specialties: Cardiology Dermatology Emergency Medicine Gastroenterology General Medicine HIV/AIDS Hospital Medicine Infectious Diseases Neurology Oncology and Hematology Pediatrics and Adolescent Medicine Psychiatry Women’s Health. Topics: Aging / Geriatrics Allergy / Asthma Arthritis/Rheumatic Disease Breast Cancer Depression / Anxiety Diabetes GERD / Peptic Ulcers Gynecology Hepatitis Hypertension Lipid Management Nutrition / Obesity Osteoporosis/Bone Disease Pediatric Infections Pregnancy / Infertility Respiratory Infections Skin Cancer STDs Stroke Substance Abuse. News. Blogs Clinical Conversations Podcast. HIV and ID Observations. Insights on Residency Training. CME. Feeds. Sign in to Your Account Get help with sign in. Email...
http://jwatch.org/na31836/2013/08/01/h-pylori-eradication-might-reduce-recurrent-gastric-cancer
*  Ulcers.and.Bacteria
It examines the nature of the discoveries made by Marshall and Warren, including the new bacteria now known as Helicobacter pylori, the hypothesis that peptic ulcers are often the result of bacterial infection, and the hypothesis that peptic ulcers can be cured by treatment with antibiotics. pylori cause ulcers Warren had noticed the association of spiral bacteria with gastritis, but a more controlled study was needed to determine the medical role of what was eventually named Helicobacter pylori. In October, 1982, Marshall obtained the statistical results of the study and noticed that only people with gastritis had the gastric spiral bacteria and that all 13 patients with duodenal ulcer had the organism. Nevertheless, Marshall and Warren published the results of their study in The Lancet, noting that the bacteria were present in almost all patients with active chronic gastritis, duodenal ulcer, or gastric ulcer and thus may be an important factor in the aetiology of these diseases Marshall and Warren, 1984, p...
http://cogsci.uwaterloo.ca/Articles/Pages/Ulcers.one.html
*  Is H. Pylori the Cause of Your Tummy Troubles? - News - Ridgecrest Daily Independent - Ridgecrest,
- News - Ridgecrest Daily Independent - Ridgecrest, CA - Ridgecrest, CA. pylori can be the culprit behind everything from stomach ulcers to bloating, burping and nausea. Ridgecrest Daily Independent - Ridgecrest, CA. Posted Feb. 23, 2013 at 12:01 AM Updated Feb 23, 2013 at 8:23 PM. Posted Feb. 23, 2013 at 12:01 AM Updated Feb 23, 2013 at 8:23 PM. You could be infected with a microscopic spiral-shaped bacterium called Heliobacter pylori, or H. pylori, which can cause a stomach pain along with bloating, burping and loss of appetite; ongoing discomfort in your upper abdomen; or nausea and vomiting. pylori during childhood, though symptoms don t show up until they re older, if at all: Plenty of individuals who carry the bacterium never have any problems. If the ulcer worsens, a person may develop intense stomach pain or bloody or black stools. H pylori may also cause gastritis and dyspepsia, which trigger ulcer-like symptoms. Symptoms include pain in the upper abdomen, nausea and vomiting and loss of appetite. Dy...
http://ridgecrestca.com/article/20130223/NEWS/302239961/196/features
*  Is H. Pylori the Cause of Your Tummy Troubles? - News - Gridley Herald - Gridley, CA - Gridley, CA
- News - Gridley Herald - Gridley, CA - Gridley, CA. Pylori the Cause of Your Tummy Troubles. pylori can be the culprit behind everything from stomach ulcers to bloating, burping and nausea. Gridley Herald - Gridley, CA. Posted Feb. 23, 2013 at 12:01 AM Updated Feb 23, 2013 at 8:23 PM. Posted Feb. 23, 2013 at 12:01 AM Updated Feb 23, 2013 at 8:23 PM. You could be infected with a microscopic spiral-shaped bacterium called Heliobacter pylori, or H. pylori, which can cause a stomach pain along with bloating, burping and loss of appetite; ongoing discomfort in your upper abdomen; or nausea and vomiting. If the ulcer worsens, a person may develop intense stomach pain or bloody or black stools. H pylori may also cause gastritis and dyspepsia, which trigger ulcer-like symptoms. Symptoms include pain in the upper abdomen, nausea and vomiting and loss of appetite. Dyspepsia is described as chronic or recurrent pain or discomfort in the upper abdomen, including bloating, gas, fullness, fatigue and nausea. And people in...
http://gridleyherald.com/article/20130223/NEWS/302239961/1637/LIFESTYLE

CagA: Helicobacter pylori virulence factor CagA (cytotoxin-associated gene A) is a 120–145kDa protein encoded on the 40kb cag pathogenicity island (PAI). H.Helicobacter pullorum: Helicobacter pullorum is a bacterium in the Helicobacteraceae family, Campylobacterales order. It was isolated from the liver, duodenum, and caecum of broiler and layer chickens, and from humans with gastroenteritis.GastritisGastric mucosal barrier: The gastric mucosal barrier is the property of the stomach that allows it to contain acid.Dodecameric protein: A dodecameric protein has a quaternary structure consisting of 12 protein subunits in a complex. Dodecameric complexes can have a number of subunit 'topologies', but typically only a few of the theoretically possible subunit arrangements are observed in protein structures.John Lykoudis: John Lykoudis (1910 in Missolonghi – 1980) was a general practitioner in Greece who treated patients suffering from peptic ulcer disease with antibiotics long before it was commonly recognized that bacteria were a dominant cause for the disease.ClarithromycinTolevamerStomach diseaseAmoxicillinNepean HospitalOmeprazoleFerric uptake regulator family: In molecular biology, the ferric uptake regulator (FUR) family of proteins includes metal ion uptake regulator proteins. These are responsible for controlling the intracellular concentration of iron in many bacteria.Reactive gastropathy: In gastroenterology, reactive gastropathy, also chemical gastropathy, is an abnormality in the stomach caused by chemicals, e.g.Sodium bismuthateGastrin: Gastrin is a peptide hormone that stimulates secretion of gastric acid (HCl) by the parietal cells of the stomach and aids in gastric motility. It is released by G cells in the pyloric antrum of the stomach, duodenum, and the pancreas.Erythromycin breath test: The erythromycin breath test (ERMBT) is a method used to measure metabolism (oxidation and elimination from the system) by a part of the cytochrome P450 system. Erythromycin is tagged with carbon-14 and given as an intravenous injection; after 20 minutes the subject blows up a balloon and the carbon dioxide exhaled that is tagged with carbon-14 shows the activity of the CYP3A4 isoenzyme on the erythromycin.Gastric erosion: Gastric erosion occurs when the mucous membrane lining the stomach becomes inflamed. Some drugs, as tablets, can irritate this mucous membrane, especially drugs taken for arthritis and muscular disorders, steroids, and aspirin.BacitracinFetor hepaticusLansoprazoleProton-pump inhibitorCombination therapy: Combination therapy or polytherapy is therapy that uses more than one medication or modality (versus monotherapy, which is any therapy taken alone). Typically, these terms refer to using multiple therapies to treat a single disease, and often all the therapies are pharmaceutical (although it can also involve non-medical therapy, such as the combination of medications and talk therapy to treat depression).TinidazoleIntestinal metaplasia: 200px|right|thumb|Intestinal metaplasia (top middle of image) of the gastric antrum and [[stomach cancer|adenocarcinoma of the stomach (left/centre of image). H&E stain.Brain biopsyRanitidineUrea reduction ratio: For the Scottish river see: Urr WaterDuodenitisFurazolidoneThermal cyclerCholesterol-dependent cytolysin: Cholesterol-dependent cytolysins (CDC) are a family of β-barrel pore-forming exotoxins that are secreted by Gram-positive bacteria. CDC are secreted as water-soluble monomers of 50-70 kDa, that once bound to the target cell, will form a circular homo-oligomeric complex containing up to 40 monomers, although it is possible that some may incorporate more monomers.Little gastrin IColes PhillipsSecretagogue: A secretagogue is a substance that causes another substance to be secreted. One example is gastrin,secretagogue at eMedicine Dictionary which stimulates the H/K ATPase in the parietal cells (increased gastric acid production by the stomach).Nodal marginal zone B cell lymphomaAntacidAntitrichomonal agent: An antitrichomonal agent is an antiprotozoal agent that acts on trichomonas parasites.E. coli nitroreductase: E. coli nitroreductase is a flavoprotein found in the bacteria Escherichia coli.Extended-spectrum penicillin: The extended-spectrum penicillins are a group of antibiotics that have the widest antibacterial spectrum of all penicillins.Comprehensive Pharmacy Review, Leon Shargel, 6th edition, p917 Some sources identify them with antipseudomonal penicillins,Elsevier's Integrated Review Pharmacology, By Mark Kester, Kelly Dowhower Karpa, Kent E.RabeprazoleCD4 immunoadhesin: CD4 immunoadhesin is a recombinant fusion protein consisting of a combination of CD4 and the fragment crystallizable region.Virulence: Virulence is, by MeSH definition, the degree of pathogenicity within a group or species of parasites as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenicity of an organism - its ability to cause disease - is determined by its virulence factors.Gentamicin protection assay: The gentamicin protection assay or survival assay or invasion assay is a method used in microbiology. It is used to quantify the ability of pathogenic bacteria to invade eukaryotic cells.Metallocene: A metallocene is a compound typically consisting of two cyclopentadienyl anions (Cp, which is C5H5−) bound to a metal center (M) in the oxidation state II, with the resulting general formula (C5H5)2M. Closely related to the metallocenes are the metallocene derivatives, e.SulfoxideFunctional gastrointestinal disorder: Functional gastrointestinal disorders (FGID) include a number of separate idiopathic disorders which affect different parts of the gastrointestinal tract and involve visceral hypersensitivity and impaired gastrointestinal motility. Heightened mast cell activation is a common factor among all FGIDs that contributes to visceral hypersensitivity as well as epithelial, neuromuscular, and motility dysfunction.Eva Engvall: Eva Engvall, born 1940, is one of the scientists who invented ELISA in 1971.Eva Engvall, The Scientist 1995, 9(18):8Seroprevalence: Seroprevalence is the number of persons in a population who test positive for a specific disease based on serology (blood serum) specimens; often presented as a percent of the total specimens tested or as a proportion per 100,000 persons tested. As positively identifying the occurrence of disease is usually based upon the presence of antibodies for that disease (especially with viral infections such as Herpes Simplex and HIV), this number is not significant if the specificity of the antibody is low.AchlorhydriaGastric acid: Gastric acid is a digestive fluid, formed in the stomach. It is composed of hydrochloric acid (HCl) .Trimeric autotransporter adhesin: In molecular biology, trimeric autotransporter adhesins (TAAs), are proteins found on the outer membrane of Gram-negative bacteria. Bacteria use TAAs in order to infect their host cells via a process called cell adhesion.Stretta procedure: Stretta is a minimally invasive endoscopic procedure for the treatment of gastroesophageal reflux disease (GERD). A catheter is used to deliver radiofrequency energy to the lower esophageal sphincter, muscle and gastric cardia.Assay sensitivity: Assay sensitivity is a property of a clinical trial defined as the ability of a trial to distinguish an effective treatment from a less effective or ineffective intervention. Without assay sensitivity, a trial is not internally valid and is not capable of comparing the efficacy of two interventions.Forrest classification: Forrest classification is a classification of upper gastrointestinal hemorrhage used for purposes of comparison and in selecting patients for endoscopic treatment.http://books.Squamous epithelial cell: In anatomy, squamous epithelium (squama- + -ous) is that whose outermost (apical) layer consists of thin, flat cells called squamous epithelial cells. The epithelium may be composed of one layer of these cells, in which case it is referred to as simple squamous epithelium, or it may possess multiple layers, referred to then as stratified squamous epithelium.Resistome: The resistome is a proposed expression by Gerard D. Wright for the collection of all the antibiotic resistance genes and their precursors in both pathogenic and non-pathogenic bacteria.Giemsa stainGlobal microbial identifier: The genomic epidemiological database for global identification of microorganisms or global microbial identifier (GMI) is a platform for storing whole genome sequencing (WGS) data of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect and track-and-trace infectious disease outbreaks and emerging pathogens. The database holds two types of information: 1) genomic information of microorganisms, linked to, 2) metadata of those microorganism such as epidemiological details.Campylobacter concisus: Campylobacter concisus is a Gram-negative, spiral, and microaerophilic bacteria. Motile, with either unipolar or bipolar flagella, the organisms have a characteristic spiral/corkscrew appearance and are oxidase-positive.Symmetry element: A symmetry element is a point of reference about which symmetry operations can take place. In particular, symmetry elements can be centers of inversion, axes of rotation and mirror planes.Endoscopy unit: An endoscopy unit refers to a dedicated area where medical procedures are performed with endoscopes, which are cameras used to visualize structures within the body, such as the digestive tract and genitourinary system. Endoscopy units may be located within a hospital, incorporated within other medical care centres, or may be stand-alone in nature.Non-communicable disease: Non-communicable disease (NCD) is a medical condition or disease that is non-infectious or non-transmissible. NCDs can refer to chronic diseases which last for long periods of time and progress slowly.DNA sequencer: A DNA sequencer is a scientific instrument used to automate the DNA sequencing process. Given a sample of DNA, a DNA sequencer is used to determine the order of the four bases: G (guanine), C (cytosine), A (adenine) and T (thymine).

(1/6695) The significance of cagA and vacA subtypes of Helicobacter pylori in the pathogenesis of inflammation and peptic ulceration.

AIMS: To assess the significance of cagA and vacA subtypes of Helicobacter pylori in relation to inflammation and density of bacterial colonisation in vivo within a dyspeptic UK population. METHODS: Dyspeptic patients who were Helicobacter pylori positive had antral samples taken for histology and culture. Gastroduodenal pathology was noted. The grade of bacterial density and inflammation was assessed using the Sydney system. Bacterial DNA was extracted and the vacA alleles and the cagA/gene typed using PCR. RESULTS: 120 patients were studied. There was high rate of cagA positive strains in this population. Bacterial density did not correlate with the presence of peptic ulceration. There was a significant association between cagA positive strains and increased inflammation and bacterial density. The vacA s1 type independently correlated with extensive chronic inflammation but there was no association with bacterial density. The vacA m type did not correlate with extent of inflammation or bacterial density. CONCLUSIONS: The results suggest that cagA is important in the pathogenesis of inflammation and peptic ulceration. These findings are in keeping with the hypothesis that cagA acts as a marker for a cag pathogenicity island which encodes several genes involved in inflammation. The vacA s1 allele correlates with inflammation independently of cagA, possibly through its enhanced ability to produce the vacuolating cytotoxin.  (+info)

(2/6695) Chemokine mRNA expression in gastric mucosa is associated with Helicobacter pylori cagA positivity and severity of gastritis.

AIM: To investigate the association between the quantity of gastric chemokine mRNA expression, severity of gastritis, and cagA positivity in Helicobacter pylori associated gastritis. METHODS: In 83 dyspeptic patients, antral and corpus biopsies were taken for semiquantitative reverse transcription polymerase chain reaction (RT-PCR) and histological grading of gastritis. Gastritis was evaluated by visual analogue scales. Quantities of chemokine (IL-8, GRO alpha, ENA-78, RANTES, MCP-1) RT-PCR products were compared with G3PDH products. Each sample was also evaluated for the presence of cagA and ureA mRNA by RT-PCR. RESULTS: mRNA expression of all five chemokines was significantly greater in H pylori positive than in H pylori negative mucosa. In H pylori positive patients, in the antrum C-X-C chemokine mRNA expression was significantly greater in cagA positive patients than in cagA negative patients, but there were no significant differences in C-C chemokine mRNA expression. In H pylori positive patients, chemokine mRNA expression in the corpus was less than in the antrum. In contrast to the antrum, only GRO alpha mRNA expression was significantly greater in cagA positive infection. Polymorphonuclear cell infiltration was correlated with C-X-C chemokine mRNA expression. Significant correlations were also found between bacterial density and C-X-C chemokine mRNA expression. CONCLUSIONS: In H pylori infection, C-X-C chemokines may play a primary role in active gastritis. Infection with cagA positive H pylori induces greater gastric chemokine mRNA expression in the antral mucosa, which may be relevant to the increased mucosal damage associated with cagA positive H pylori infection.  (+info)

(3/6695) Helicobacter pylori infection, garlic intake and precancerous lesions in a Chinese population at low risk of gastric cancer.

BACKGROUND: Cangshan County of Shandong Province has one of the lowest rates of gastric cancer (GC) in China. While intestinal metaplasia (IM) and dysplasia (DYS) are less common in Cangshan than in areas of Shandong at high risk of GC, these precursor lesions nevertheless affect about 20% of adults age > or = 55. SUBJECTS AND SETTING: In order to evaluate determinants of IM and DYS in Cangshan County, a low risk area of GC a survey was conducted among 214 adults who participated in a gastroscopic screening survey in Cangshan County in 1994. METHOD: A dietary interview and measurement of serum Helicobacter pylori antibodies were performed. RESULTS: The prevalence of H. pylori was lowest (19%) among those with normal gastric mucosa, rising steadily to 35% for superficial gastritis (SG), 56% for chronic atrophic gastritis (CAG), 80% for IM, and 100% for DYS. The prevalence odds of precancerous lesions were compared with the odds of normal histology or SG. The odds ratio (OR) or CAG associated with H. pylori positivity was 4.2 (95% confidence interval [CI] : 1.7-10.0), while the OR of IM/DYS associated with H. pylori positivity was 31.5 (95% CI: 5.2-187). After adjusting for H. pylori infection, drinking alcohol was a risk factor for CAG (OR = 3.2, 95% CI: 1.1-9.2) and IM/DYS (OR = 7.8, 95% CI: 1.3-47.7). On the other hand, consumption of garlic showed non-significant protective effects and an inverse association with H. pylori infection. CONCLUSIONS: The findings of this study suggest that infection with H. pylori is a risk factor and garlic may be protective, in the development and progression of advanced precancerous gastric lesions in an area of China at relatively low risk of GC.  (+info)

(4/6695) Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates.

BACKGROUND: cag pathogenicity island (PAI) is reported to be a major virulence factor of Helicobacter pylori. AIM: To characterise cagA and the cag PAI in Japanese H pylori strains. METHODS: H pylori isolates from Japanese patients were evaluated for CagA by immunoblot, for cagA transcription by northern blot, and for cagA and 13 other cag PAI genes by Southern blot. cagA negative strains from Western countries were also studied. Induction of interleukin-8 secretion from gastric epithelial cells was also investigated. RESULTS: All Japanese strains retained cagA. Fifty nine of 63 (94%) strains had all the cag PAI genes. In the remaining four, cag PAI was partially deleted, lacking cagA transcripts and not producing CagA protein. Details of the PAI of these strains were checked; three lacked cagB to cagQ (cagI) and continuously cagS to cag13 (cagII), and the remaining one lacked cagB to cag8. Western cagA negative strains completely lacked cag PAI including cagA. Nucleotide sequence analysis in one strain in which the cag PAI was partially deleted showed that the partial deletion contained 25 kb of cag PAI and the cagA promoter. Interleukin-8 induction was lower with the cag PAI partial deletion strains than with the intact ones. All Japanese cag PAI deleted strains were derived from patients with non-ulcer dyspepsia, whereas 41 of 59 (70%) CagA-producing strains were from patients with peptic ulcers or gastric cancer (p<0.05). CONCLUSIONS: Most Japanese H pylori strains had the intact cag PAI. However, some lacked most of the cag PAI in spite of the presence of cagA. Thus the presence of the cagA gene is not an invariable marker of cag PAI related virulence in Japanese strains.  (+info)

(5/6695) Chronic infection with Helicobacter pylori, Chlamydia pneumoniae, or cytomegalovirus: population based study of coronary heart disease.

OBJECTIVE: To study possible associations between coronary heart disease and serological evidence of persistent infection with Helicobacter pylori, Chlamydia pneumoniae, or cytomegalovirus. DESIGN: Population based, case-control study, nested within a randomised trial. SETTING: Five general practices in Bedfordshire, UK. INDIVIDUALS: 288 patients with incident or prevalent coronary heart disease and 704 age and sex matched controls. RESULTS: High concentrations of serum IgG antibodies to H pylori were present in 54% of cases v 46% of controls, with corresponding results for C pneumoniae seropositivity (33% v 33%), and cytomegalovirus seropositivity (40% v 31%). After adjustments for age, sex, smoking, indicators of socioeconomic status, and standard risk factors, the odds ratios (95% confidence intervals) for coronary heart disease of seropositivity to these agents were: 1.28 (0.93 to 1.75) for H pylori, 0.95 (0.66 to 1.36) for C pneumoniae, and 1.40 (0.96 to 2. 05) for cytomegalovirus. CONCLUSIONS: There is no good evidence of strong associations between coronary heart disease and serological markers of persistent infection with H pylori, C pneumoniae, or cytomegalovirus. To determine the existence of moderate associations between these agents and disease, however, larger scale studies will be needed that can keep residual confounders to a minimum.  (+info)

(6/6695) Multiplex sequence analysis demonstrates the competitive growth advantage of the A-to-G mutants of clarithromycin-resistant Helicobacter pylori.

Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates.  (+info)

(7/6695) Helicobacter pylori vacuolating toxin forms anion-selective channels in planar lipid bilayers: possible implications for the mechanism of cellular vacuolation.

The Helicobacter pylori VacA toxin plays a major role in the gastric pathologies associated with this bacterium. When added to cultured cells, VacA induces vacuolation, an effect potentiated by preexposure of the toxin to low pH. Its mechanism of action is unknown. We report here that VacA forms anion-selective, voltage-dependent pores in artificial membranes. Channel formation was greatly potentiated by acidic conditions or by pretreatment of VacA at low pH. No requirement for particular lipid(s) was identified. Selectivity studies showed that anion selectivity was maintained over the pH range 4.8-12, with the following permeability sequence: Cl- approximately HCO3- > pyruvate > gluconate > K+ approximately Li+ approximately Ba2+ > NH4+. Membrane permeabilization was due to the incorporation of channels with a voltage-dependent conductance in the 10-30 pS range (2 M KCl), displaying a voltage-independent high open probability. Deletion of the NH2 terminus domain (p37) or chemical modification of VacA by diethylpyrocarbonate inhibited both channel activity and vacuolation of HeLa cells without affecting toxin internalization by the cells. Collectively, these observations strongly suggest that VacA channel formation is needed to induce cellular vacuolation, possibly by inducing an osmotic imbalance of intracellular acidic compartments.  (+info)

(8/6695) The vacuolating toxin from Helicobacter pylori forms hexameric pores in lipid bilayers at low pH.

Pathogenic strains of Helicobacter pylori secrete a cytotoxin, VacA, that in the presence of weak bases, causes osmotic swelling of acidic intracellular compartments enriched in markers for late endosomes and lysosomes. The molecular mechanisms by which VacA causes this vacuolation remain largely unknown. At neutral pH, VacA is predominantly a water-soluble dodecamer formed by two apposing hexamers. In this report, we show by using atomic force microscopy that below pH approximately 5, VacA associates with anionic lipid bilayers to form hexameric membrane-associated complexes. We propose that water-soluble dodecameric VacA proteins disassemble at low pH and reassemble into membrane-spanning hexamers. The surface contour of the membrane-bound hexamer is strikingly similar to the outer surface of the soluble dodecamer, suggesting that the VacA surface in contact with the membrane is buried within the dodecamer before protonation. In addition, electrophysiological measurements indicate that, under the conditions determined by atomic force microscopy for membrane association, VacA forms pores across planar lipid bilayers. This low pH-triggered pore formation is likely a critical step in VacA activity.  (+info)


How do you get infected with Helicobacter pylori?


One week ago I was diagnosed with the infection of Helicobacter Pylori, that bacteria is such a bitch that it can cause you stomach cancer.

I am under treatment but I wonder how is that I got that infection. If you know let me know please.

Thank you
----------

"H. Pylori is bacterial/viral but it is believed to be transmitted orally so it might be contagious. Many researchers think that H. pylori is transmitted orally by means of fecal matter through the ingestion of waste tainted food or water. A clean and hygienic environment can help decrease the risk of H. Pylori infection."

--so says the wonderful page of Wikipedia


Do I need to take antibiotic to cure helicobacter pylori?


Hi, my helicobacter pylori test (both blood and breath test) is positive but i do not feel any symptom. Do I need to take antibiotic? I am struggling about this.
----------

You must have felt some symptoms, or they would not have done this test on you.  Testing for H. pylori is usually done because a person is sick or has stomach pains.

To better answer your question.... it is not known how many people have H pylori.  There is an assumption that some people have the bacteria but don't really have any problems with it.  It is known, however, that some people with chronic abdomianl pain (ulcers) have the bacteria and the problem does not go away until the bacteria are killed with antibiotics.

So.... whether or not you need the antibiotic is between you and your doctor.  As I said in my first sentence, you must have had some symptom or problem if you were tested.  So if you came up positive, then you probably need to take the antibiotic.  It is a common antibiotic and not very expensive.


Where can I buy Helicobacter pylori bacteria?


I am doing a science project and one of the materials it requires is Helicobacter pylori and there is nowhere online I can find the bacteria, so if anyone has any sites they would like to recommend or any stores.
----------

Im not sure but make sure you buy a strain that does not have the CagA pathogen island or you could get infected and have some serious complications over time like an ulcer or stomach cancer.


Do you know that helicobacter pylori bacteria might have a role in allergy to paprika?


I became allergic to paprika and some spices since two and a half years ago. My blood test proved positive for helicobacter pylori and I got Claritromicine pills for 3 weeks. After the treatment I got rid of allergy to paprika and spices too.
----------

if you have that bacteria, you need stomach meds....a specific ntibiotic so you wont get an ulcer...or reflux that never ends..


How were peptic ulcers treated before Barry Marshall discovered Helicobacter pylori?


How were peptic ulcers treated before Barry Marshall discovered Helicobacter pylori?
----------

Treated with tagamet(cimitidine) or ranitidine plus anacide ,antispasmodic like librax


What could I do about fatigue and dizziness caused by H pylori?


I have fatigue, dizziness, and lack of coordination caused by helicobacter pylori. I am going to the doctor tomorrow but what could I do and avoid in the meantime to overcome this?
----------

How do you know those are related to H pylori? I've never heard of those being related. If you're having lack of coordination, dizziness and fatigue, plus stomach issues, I would look into something like celiac disease. Loss of coordination was a major symptom I had for celiac. I thought I had MS and that's what it turned out to be. Make sure to tell your doctor about all your symptoms and let him run tests to see what's causing this. Good luck!

http://digestive.niddk.nih.gov/ddiseases/pubs/celiac/
http://www.csaceliacs.org/celiac_symptoms.php


if i have h pylori will it affect the results of a pregnancy test?


Hi I'm fifteen and I recently discovered that I have helicobacter pylori. I think I may be pregnant but I read that some diseases affect home pregnancy tests and I just need to know if h pylori is one of them. So anyone with information please help me.
----------

IT should not prevent you getting the correct pregnancy result.
Helicobacter Pylori is in your gut.

Am I to assume the doctor is treating it with an antibiotic and an ulcer healer tablet? Also does your doctor know you may be pregnant? because their are certain antibiotics that a doctor will not give when you are pregnant.


Is a stool test for helicobacter pylori more accurate than any other test?


Because I don't know why the hell my doctor wants me to shit in a cup instead of just ordering a blood or breath test.  Is it more accurate or something?  I had over 9 vials of blood drawn the other day to test for everything from thyroid problems to mono to anemia, all just because I'm having acid reflux AFTER I WAS ON SUPER HIGH DOSES OF PREDNISONE!  Uh, hello!  Could that be the cause?!!?!?!  *rolls eyes*  I KNOW that I don't have ulcers caused by the helicobacter pylori, as does she, but she's just being a fucking douche bag.

Anyway, I'm irritated that I have to shit in a cup.  It's fucking embarrassing and stupid.  It's also a HUGE inconvenience to have to drive over 45 minutes to the hospital to drop it off.  She seems like a fucking wack-job to me.

What do you think?  Thanks a lot.
----------

I found a link for you that describes all the tests.

Apparently, the breath test is about as accurate as the stool test.  The drawback of the breath test is that you have to swallow a radioactive compound, which means it probably has to be done in the nuclear medicine department of a hospital.  The blood test is less accurate, since it will show positive if you have had H. pylori before and recovered.

Doctors ask for stool samples all the time, and often forget how disgusting all of us patients think it is.  Under the circumstances, the stool test seems to be the simplest and most likely to yield usable results.

Prednisone can cause ulcers.  If you have H. pylori, the ulcers are unlikely to go away on their own.

This sounds like a rather extensive workup for reflux, which most patients treat on their own with over-the-counter medications.  Other than that, I don't consider your doctor to be a whack job.