DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Templates, Genetic: Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.HIV Reverse Transcriptase: A reverse transcriptase encoded by the POL GENE of HIV. It is a heterodimer of 66 kDa and 51 kDa subunits that are derived from a common precursor protein. The heterodimer also includes an RNAse H activity (RIBONUCLEASE H, HUMAN IMMUNODEFICIENCY VIRUS) that plays an essential role the viral replication process.RNA-Directed DNA Polymerase: An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC H: A ribonuclease that specifically cleaves the RNA moiety of RNA:DNA hybrids. It has been isolated from a wide variety of prokaryotic and eukaryotic organisms as well as RETROVIRUSES.Euplotes: A genus of ciliate protozoa having a dorsoventrally flattened body with widely spaced rows of short bristle-like cilia on the dorsal surface.Deoxyguanine Nucleotides: Guanine nucleotides which contain deoxyribose as the sugar moiety.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.DNA-Directed DNA Polymerase: DNA-dependent DNA polymerases found in bacteria, animal and plant cells. During the replication process, these enzymes catalyze the addition of deoxyribonucleotide residues to the end of a DNA strand in the presence of DNA as template-primer. They also possess exonuclease activity and therefore function in DNA repair.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Dideoxynucleotides: The phosphate esters of DIDEOXYNUCLEOSIDES.DNA Replication: The process by which a DNA molecule is duplicated.Telomerase: An essential ribonucleoprotein reverse transcriptase that adds telomeric DNA to the ends of eukaryotic CHROMOSOMES.Aphidicolin: An antiviral antibiotic produced by Cephalosporium aphidicola and other fungi. It inhibits the growth of eukaryotic cells and certain animal viruses by selectively inhibiting the cellular replication of DNA polymerase II or the viral-induced DNA polymerases. The drug may be useful for controlling excessive cell proliferation in patients with cancer, psoriasis or other dermatitis with little or no adverse effect upon non-multiplying cells.DNA, Single-Stranded: A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.DNA Polymerase I: A DNA-dependent DNA polymerase characterized in prokaryotes and may be present in higher organisms. It has both 3'-5' and 5'-3' exonuclease activity, but cannot use native double-stranded DNA as template-primer. It is not inhibited by sulfhydryl reagents and is active in both DNA synthesis and repair. EC Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.Nucleotides: The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Reverse Transcriptase Inhibitors: Inhibitors of reverse transcriptase (RNA-DIRECTED DNA POLYMERASE), an enzyme that synthesizes DNA on an RNA template.Kinetics: The rate dynamics in chemical or physical systems.RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.HIV-1: The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Random Amplified Polymorphic DNA Technique: Technique that utilizes low-stringency polymerase chain reaction (PCR) amplification with single primers of arbitrary sequence to generate strain-specific arrays of anonymous DNA fragments. RAPD technique may be used to determine taxonomic identity, assess kinship relationships, analyze mixed genome samples, and create specific probes.Sensitivity and Specificity: Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.RNA, Transfer, Lys: A transfer RNA which is specific for carrying lysine to sites on the ribosomes in preparation for protein synthesis.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.RNA, Ribosomal, 16S: Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.DNA, Ribosomal: DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.DNA Primase: A single-stranded DNA-dependent RNA polymerase that functions to initiate, or prime, DNA synthesis by synthesizing oligoribonucleotide primers. EC 2.7.7.-.Methacrylates: Acrylic acids or acrylates which are substituted in the C-2 position with a methyl group.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Dental Bonding: An adhesion procedure for orthodontic attachments, such as plastic DENTAL CROWNS. This process usually includes the application of an adhesive material (DENTAL CEMENTS) and letting it harden in-place by light or chemical curing.Genes, Bacterial: The functional hereditary units of BACTERIA.Nucleic Acid Amplification Techniques: Laboratory techniques that involve the in-vitro synthesis of many copies of DNA or RNA from one original template.Resin Cements: Dental cements composed either of polymethyl methacrylate or dimethacrylate, produced by mixing an acrylic monomer liquid with acrylic polymers and mineral fillers. The cement is insoluble in water and is thus resistant to fluids in the mouth, but is also irritating to the dental pulp. It is used chiefly as a luting agent for fabricated and temporary restorations. (Jablonski's Dictionary of Dentistry, 1992, p159)Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Oligonucleotides: Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)Oligonucleotide Probes: Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.Taq Polymerase: A heat stable DNA-DIRECTED DNA POLYMERASE from the bacteria Thermus aquaticus. It is widely used for the amplification of genes through the process of POLYMERASE CHAIN REACTION. EC 2.7.7.-.DNA Fingerprinting: A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.Electrophoresis, Agar Gel: Electrophoresis in which agar or agarose gel is used as the diffusion medium.DNA, Plant: Deoxyribonucleic acid that makes up the genetic material of plants.Microsatellite Repeats: A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Polymorphism, Restriction Fragment Length: Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)DNA, Fungal: Deoxyribonucleic acid that makes up the genetic material of fungi.Genetic Variation: Genotypic differences observed among individuals in a population.Shear Strength: The internal resistance of a material to moving some parts of it parallel to a fixed plane, in contrast to stretching (TENSILE STRENGTH) or compression (COMPRESSIVE STRENGTH). Ionic crystals are brittle because, when subjected to shear, ions of the same charge are brought next to each other, which causes repulsion.Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Genetic Markers: A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.Bacterial Proteins: Proteins found in any species of bacterium.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.DNA, Ribosomal Spacer: The intergenic DNA segments that are between the ribosomal RNA genes (internal transcribed spacers) and between the tandemly repeated units of rDNA (external transcribed spacers and nontranscribed spacers).RNA, Ribosomal, 18S: Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.Dentin-Bonding Agents: Cements that act through infiltration and polymerization within the dentinal matrix and are used for dental restoration. They can be adhesive resins themselves, adhesion-promoting monomers, or polymerization initiators that act in concert with other agents to form a dentin-bonding system.RNA Nucleotidyltransferases: Enzymes that catalyze the template-directed incorporation of ribonucleotides into an RNA chain. EC 2.7.7.-.Gene Library: A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.

*  Custom DNA Primers | Thermo Fisher Scientific
Custom DNA Primers. Thermo Fisher Scientific. Contact Us. ... Cloning. DNA & RNA Purification. Gene Expression ... ™ Reagents. Oligos, Primers, Probes & Nucleotides. TaqMan® Real-...
*  OriGene - CD40 (NM 001250) qPCR Primer Pair
CD40 NM_001250 qPCR Primer Pair. My Account. Shopping Cart. ... Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master ... Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. ... origene cd nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair cd gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  Custom DNA Primers | Thermo Fisher Scientific
Custom DNA Primers. Thermo Fisher Scientific. Order ... Cloning. DNA & RNA Purification. Gene Expression ... GlobalFiler™ Kits. DNA Quantification Solutions. PGM for...
*  NMR Investigation of DNA Primer-Template Models: Guanine Templates Are Less Prone to S
Investigation of DNA Primer-Template Models: Guanine ... Investigation of DNA Primer-Template Models: Guanine...
*  Система диметилсульфоксид + спирт
structures in the DNA template or the DNA primers. DMSO is...
Methods-DNA was obtained from whole blood samples ... two oligonucleotide primers ACE1 and ACE3 outside the insertion ... sequence and one primer ACE2 inside the sequence. Microtitre ... RAPID METHODS FOR POPULATION-SCALE ANALYSIS FOR GENE POLYMORPHISMS - THE ACE GENE AS AN EXAMPLE - UCL Discovery. UCL Discovery. About UCL Discovery. RAPID METHODS FOR POPULATION-SCALE ANALYSIS FOR GENE POLYMORPHISMS - THE ACE GENE AS AN EXAMPLE. RAPID METHODS FOR POPULATION-SCALE ANALYSIS FOR GENE POLYMORPHISMS - THE ACE GENE AS AN EXAMPLE. Abstract Objective-To obtain rapid, high throughput genotyping of the angiotensin converting enzyme ACE gene intron 16 insertion/deletion polymorphism.Methods-DNA was obtained from whole blood samples by a simple liquid phase methanol extraction procedure. The ACE gene was amplified by the polymerase chain reaction PCR using two oligonucleotide primers ACE1 and ACE3 outside the insertion sequence and one primer ACE2 inside the sequence. Microtitre array diagonal gel electrophoresis MAD...
*  TP53 Gene - GeneCards | P53 Protein | P53 Antibody
Inhib. RNA. Primers. PCR Panel. Regul. Elements. Show ... Assays Genes shRNA Primers CRISPR. Genes Peptides Proteins CRISPR ... activation, DNA binding, and oligomerization domains. ... Origene Custom Protein Services for TP53 Origene siRNA, shRNA, and RNAi products in human, mouse, rat for TP53. Pathway & Disease-focused RT² Profiler PCR Arrays Apoptosis in human, mouse, rat Apoptosis 384HT in human, mouse, rat Autophagy in human, mouse, rat Breast Cancer in human, mouse, rat Cancer Drug Resistance in human, mouse, rat Cancer Drug Targets in human, mouse, rat Cell Cycle in human, mouse, rat Cell Death PathwayFinder in human, mouse, rat Cellular Senescence in human, mouse, rat DNA Damage Signaling Pathway in human, mouse, rat EGF / PDGF Signaling Pathway in human, mouse, rat Hedgehog Signaling Pathway in human, mouse, rat Huntingtons Disease in human, mouse, rat Hypoxia Signaling Pathway in human, mouse, rat Leukemia in human, mouse, rat Liver Cancer in human, mouse, rat Lung Cancer in human, mous...
*  Designing primers - OpenWetWare
... Designing primers From OpenWetWare Difference between revisions Jump to: navigation, search Revision as of 19:14, 21 July 2005 view source Barry Canton Talk. contribs → Useful Primer Design Tools ← Previous diff. Revision as of 19:14, 21 July 2005 view source Barry Canton Talk. contribs → Useful Primer Design Tools Next diff →. ==Useful Primer Design Tools==. ==Useful Primer Design Tools==. * - online tool for generating the complement, reverse complement and restriction enzyme site analysis of a DNA sequence. It also translates the sequence and gives the amino acids properties. * - online tool for generating the complement, reverse complement and restriction enzyme site analysis of a DNA sequence. It also translates the sequence and gives the amino acids properties. - * - A relatively complete suite of online tools for primer analysis. + * - A relatively complete suite of online tools for primer analysis. Revision as of 19:14, 21 July 2005. Molecular Cloning says that 5' tails do not significantly affec...
*  Human COPS2 Primer Pair | cusabio.com
Human COPS2 Primer Pair. cusabio.com. CUSABIO is your good partner in biology research. All Kit Protein Antibody Molecular Biology Product Small Molecule Raw Material of IVD Kit. About us. Cusabio Story. Picture Gallery. Company Structure. Cusabio News. Kit. Protein. Antibody. Molecular Biology Product. Small Molecule. Raw Material of IVD Kit. Antibody Service. Protein Services. Molecular Biology Service. Small molecule Service. ELISA Service. Technical Support. Contact Us. Product Center Kit ELISA Kit. Protein Native Protein. Molecular Biology Product RT-PCR Primers. Small Molecule Standards. Food Safety Small Molecule Antigen. Other Small Molecule Antigen. Raw Material of IVD Kit Diagnostic Antibody. Diagnostic Antigen. New Product Rat Tpsb2 Primer Pair 2 Rat Xcl1 Primer Pair Human PTK7 Primer Pair Mouse Traf6 Primer Pair 2 Human SRD5A2 Primer Pair 2 Human PCK1 Primer Pair 1 Human PCK1 Primer Pair 3 Human JAM2 Primer Pair Human CASR Primer Pair Human PARP11 Primer Pair 1. Molecular Biology Product. RT-PCR P...
*  exon primer design program
... TM tmargus at ebc.ee. Tue Sep 21 12:48:34 EST 2004. Previous message: exon primer design program Next message: software for chromatine ImmunoPrecipitation Messages sorted by:. Hi, Tary http://bioinfo.ebc.ee/PrimerStudio/ You can uploud geneID's from a file. But selection of organisms are predefined human cerevisiae and so on Tony Tunu Margus On 6 Sep 2004 11:46:05 +0100, Jim jjliu at cs.nchu.edu.tw wrote: Dear All, Could you tell me any exon primer design program that can process gene sequences in batch mode. I hope to design both primer on the same exon and I have 250 gene sequences that need to be process. I think primer3 didn't consider about exon information. So I need the proper program or web database. Do you have any comment. Thanks. Jim Chun-Chi Liu. Email: jjliu at cs.nchu.edu.tw Institute of Computer Science, National Chung-Hsing University, Taichung, Taiwan, ROC. --- -- Using Opera's revolutionary e-mail client: http://www.opera.com/m2/. Previous message: exon primer design program Next messag...
*  Real Time PCR Primer Design - Real Time PCR Probe Design - GenScript
... Japan http://www.genscript.jp. Reward Center. Services. Close. Gene Services. Gene Synthesis. GenPlus Next-Gen HT Gene Synthesis. GenBrick Long Gene Synthesis. Express Gene Synthesis. ORF cDNA Clones and Custom Clones. Gene Variant Libraries. DNA Sequencing. CRISPR Services. Genome-edited cell lines. Peptide Services. Peptide Synthesis. Peptide Library. Peptide Array. Large-Scale Peptide Synthesis. Cosmetic Peptide Synthesis. cGMP Peptide Synthesis. Click Peptide Synthesis. Peptoid Synthesis. Protein Services. Recombinant Antibody Services. Stable Cell Lines. Large Scale Production. Other Protein Services. Antibody Services. Ab Drug Development. Anti-idiotype Ab Services. Recombinant Ab Services. Scale-up Services. Other Ab Services. Discovery Biology. Antibody Sequencing. Cell Lines Services. Protein Production Stable Cell Lines. Assay Development Stable Cell Lines. Products. Close. Antibodies. Recombinant Proteins. Protein Isolation and Analysis. Molecular Biology Reagents. PCR Reagents. Bioinformatics...
*  dna - Primer Dimer / Hairpin Algorithms - Biology Stack Exchange
... Biology. Biology Meta. more stack exchange communities. Stack Exchange. sign up log in tour. Help Center Detailed answers to any questions you might have. Meta Discuss the workings and policies of this site. Biology Questions. Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. Primer Dimer / Hairpin Algorithms. up vote 5 down vote favorite. What are the algorithms / methods in use for the calculation of primer dimers and hairpins. dna bioinformatics pcr primer share. 1 Answer 1 active oldest votes. up vote 2 down vote. compute hairpin-loop, dimer, bases penality and melting temperature about primer or pair primer. with google you could find more tools but you must choose a tool of a sequencing team. he is a little english, but he could support you: http://promix.cribi.unipd.it/cgi-bin/promix/melting/melting main.exe. Sign up or log in Sign up using Google. discard By posting your answer, you agree to the privacy policy and terms of service. Browse other...
*  Silver: Commonly Used Primers - OpenWetWare
silver commonly used primers openwetware silver commonly used primers from openwetware revision as of january by carolineajo franklin talk contribs diff older revision current revision diff newer revision diff jump to navigation search commonly used primers sequencing primers for biobrick biofusion vectors v v forward sequencing primer gggttttcccagtcacgacg v v reverse sequencing primer tgtggaattgtgagcggataaca v forward sequencing primer tttctggaattcgcggcc v reverse sequencing primer gccggactgcagcggcc primers that sequence regions between the biobrick ends upstream of a kozak region k tctagtctccatggtggcgg downstream of a kozak region k ccgccaccatggagactaga upstream of the adh terminator l cctgagaaagcaacctgacctacag downstream of midpoint btwn yeast codon optimized yfp mcherryx z or z ggtaccgcaactagagcaactagc upstream of midpoint btwn yeast codon optimized yfp mcherryx z or z gctagttgctctagttgcggtacc retrieved from http www openwetware org wiki silver commonly used primers views page talk view source history per...
*  Primer Premier
... software combines design of primers for various pcr applications under one common platform the software supports design of degenerate primers on alignments for amplifying related set of nucleotide sequences for detecting common traits among organisms and to determine heredity zhaohui s wenling z bao z rong s wenli m microarrays for the detection of hbv and hdv pmid the software also designs tagged and nested primers for multiplex pcr reactions sensitivity specificity and stability of the tag primer nested multiplex pcr for malaria diagnosis guo ck li xm li jh mao w lin z du jf huang ty pmid the primer premier software supports motif analysis and orf search along with finding restriction cut sites on the nucleotide sequence the software has a built in nucleotide protein and protein nucleotide sequence translator which can be used for designing degenerate primers for codons that code for multiple amino acid sequences it is also understood that the primers designed by primer premier are effective and confir...
*  Primer3Plus
... will be replace by tooltip text Primer3Plus pick primers from a DNA sequence Primer3Manager Help. About Source Code. Task:. Detection Cloning Sequencing Primer List Primer Check. Select primer pairs to detect the given template sequence. Optionally targets and included/excluded regions can be specified. Mark an included region to pick primers fixed at its the boundaries. The quality of the primers might be low. Pick a series of primers on both strands for sequencing. Optionally the regions of interest can be marked using targets. Returns a list of all possible primers the can be designed on the template sequence. Optionally targets and included/exlcuded regions can be specified. Evaluate a primer of known sequence with the given settings. JavaScript is not enabled, please enable JavaScript and refresh the browser, or click this link for the non-Javascript version. Main. General Settings. Advanced Settings. Internal Oligo. Penalty Weights. Sequence Quality. Sequence Id:. Primer to test:. Paste source sequ...
*  User:Jarle Pahr - OpenWetWare
... Beyond the Genome: http://www.beyond-the-genome.com/. Beyond the Genome: http://www.beyond-the-genome.com/. 20 Wiki sites 20.1 Discussion and communities 20.2 Apps 20.3 Persons/Research groups 20.4 Publications 20.5 Publishers 20.6 Databases/Repositories 20.7 Codon usage 20.8 Other informational resources 20.9 Programming 20.10 Law and ethics 20.11 Cloning 20.12 Sequencing 20.13 Software tools 20.14 Systems Biology 20.15 Bioinformatics Annotation 20.16 Cloning Construction 20.17 Protocols 20.17.1 Misc. Cloning. DNA. iGEM. Synthetic Biology. Bioinformatics algorithms: https://www.coursera.org/course/bioinformatics. Foreign Service Institute language courses - Standard Chinese, a modular approach: http://www.fsi-language-courses.org/Content.php?page=Chinese. AddGene molecular biology reference: http://www.addgene.org/mol_bio_reference/. Journal of molecular biology Elsevier Partial http://www.journals.elsevier.com/journal-of-molecular-biology/. Molecular Systems Biology EMBO/Nature Publishing Group Yes htt...
*  Oligo, Sequencing Primer, Lambda gt10, Forward (27mer) - United States Biological
oligo sequencing primer lambda gt forward mer united states biological login email password forgot your password new user remember me home distributors technical about register antibodies biochemicals culture media custom services growth factors bioassay kits lectins molecular biology serum tissues protocols newsletter about us contact you are here home molecular biology mb cloning primers oligo sequencing primer lambda gt forward mer oligo sequencing primer lambda gt forward mer pricing for pricing information usa customers sign in outside usa please contact your distributor for pricing specifications catalog o single stranded non phosphorylated oligonucleotide primer chemically synthesized suitable for dna synthesis applications special labels biotin fluorescein and phosphate modifications can be included at the or site for special labels add b f p and to the catalog number form supplied as a lyophilized powder reconstitution reconstitute with sterile dh o te or tris ph purity purified by hpsf activity ug e...
*  Oligo, Sequencing Primer, M13 (-20) Forward (17mer) [5’-GTA AAA CGA CGG CCA GT-3’] - United States
oligo sequencing primer m forward mer united states biological login email password forgot your password new user remember me home distributors technical about register antibodies biochemicals culture media custom services growth factors bioassay kits lectins molecular biology serum tissues protocols newsletter about us contact you are here home molecular biology mb cloning primers oligo sequencing primer m forward mer oligo sequencing primer m forward mer pricing for pricing information usa customers sign in outside usa please contact your distributor for pricing specifications catalog o single stranded non phosphorylated oligonucleotide primer chemically synthesized suitable for dna synthesis applications special labels biotin fluorescein and phosphate modifications can be included at the or site for special labels add b f p and to the catalog number form supplied as a lyophilized powder reconstitution reconstitute with sterile dh o te or tris ph purity purified by hpsf activity ug equals od unit a quality ...
*  PCR primer problem
... Loredana Soceneantu socenean at icrf.icnet.uk. Thu Nov 2 09:53:02 EST 1995. Previous message: Staden pack Next message: PCR primer problem Messages sorted by:. Hi, I am attempting to insert 6 Histidine codons and two restriction sites just prior to the stop codon, and have not succeeded with site directed mutagenesis methods. I keep getting deletion mutants. So I switched to PCR to try to insert these 30 or so bp. I'm looking for a 1kb product, and I am using a 5' primer that anneals perfectly to the template and a 3' primer which anneals for 30 bp each at the 5' and 3' ends of the primer, but also has a big loop of 30 bp in between the annealing spots. I think that the large and difficult 3' the primer is the reason that I get no product. The template, dNTPs and Vent polymerase all work, I get results with control primers. I have tried different polymerases pfu and varied the Mg concentration with Vent from 2-10mM in 2 mM increments, tried adding 5% and 10% DMSO, and 100ug/ml BSA, all in separte reactio...
*  Single Primer PCR
... Reamplification with a nested primer and the original outside primer generates a product with unique ends. Another advantage of the long method is that the product has unique ends, allowing convergent sequencing. When amplifying out of inverted repeats at the ends of certain elements such as Tn10 or Tn5, gel purify bands before sequencing. In an appendix at the end, I present some primers which have worked well in our lab when sequencing out of common insertion sequences. Protocol Single primer PCR works best when when there are nested primers Po and Pn with sites in the known region:. 3 L 4 dNTPs @ 2 mM each. 3 L Po @ 5 M. Sequence with primer Pn. 2 Long Method Stringency optimization is done with Po, and reamplification using a biased ratio of Po and Pn. 3 L 4 dNTPs @ 2 mM each. 3 L Po @ 5 M. Usually, all such bands are anchored at the specific site corresponding to Po. Running the first and second amplification products side by side will reveal correctly anchored bands, as they will be shifted with re...
*  Long PCR primers
... andrew j doherty a doherty at bristol ac uk mon oct est previous message est dna conc from phenolicky tissue next message long pcr primers messages sorted by hi every one i ve got a pcr primer which is nucleotides long containing the c myc epitope tag and three overlapping restriction sites but only nucleotides at the end are complementary to the sequence i m trying to amplify is this a feasible primer to use i haven t had it synthesised yet and just wanted some feedback on whether i was barking mad to even attempt to pcr with such a primer will i have to start at a lower annealing temp for a few cycles or would a single temp pcr do it just for the record i m amplifiying gfp from a plasmid to make fusion proteins ta very much andy dr andrew doherty department of anatomy school of medical sciences university walk bristol uk bs td e mail a doherty at bristol ac uk previous message est dna conc from phenolicky tissue next message long pcr primers messages sorted by more information about the methods mailing...
*  how to check primers - Molecular Biology
... Protocol. Forum Index Home. Top : Forum Archives : : Molecular Biology how to check primers - Aug/25/2006 Hi everybody, I have been trying to clone many genes at the same time, so I decided to go for blunt end cloning, as I had many problems with the Gateway-Invitrogen people and their products. So, finally I got some positives, and when sequencing I see that the first codon the ATG is missing....and the final base from the last codon at the 3' end, is missing as well. The rest is as it should be. I checked again the list from when I ordered the primers, and I didn't do any mistake. Several colonies I sequenced from the same clone, showed the same. Do you think it is possible the company made a mistake when producing the primer or are you familiar with this artifact if it is so. Now I will order new primers to another company, but I wonder what is this. I had ordered oligos from MWG and had problems with getting positives. As later confirmed by the company upon complaint, the sequence was wrong. ...
*  cDNA primer help - Homework Questions
... BioJob. BioBlog. PubAlert. BioTool. BioProduct. Protocol. Forum Index Home. Top : Forum Archives : : Homework Questions cDNA primer help - Nov/15/2008 Hi everyone, I have done my search on this in these forums and it seems that still after 4 hours of reading I'm still a bit confused on this matter. I did the Blast on the Mus musculus amyloid beta gene and in order for me to design the primer I need to click the CDS button to align the sequence from the staring codon with ATG. So now I need to design the primer! My question is, when designing a primer, is this cDNA sequence going from 5'--->3' and therefore in order to design the primer I have to base pair the primer from the 3' end so that 5'starts with the primer I'm designing??. Also, the primer must have a Tm of at least 68-72 degrees and gc% of 50%. For example: I need to highlight the primer positions and write the primer sequences and Tms for the primers which I'm going to use for the PCR. would the blue be the l...
*  PCR Primer Extension
... bob delisio delisior at rnisd dnet roche com thu may est previous message dig fun pressure sensitive membranes next message serine protease substrates a summary messages sorted by pcr primer extension is a way to boost the signal of ordinary primer extensions by pcr in most cases primer extension alone produces a very weak signal when using human mrna as template i was therefore curious to know whether someone has already solved this problem i have thought of extending the cdna with terminal deoxynucleotidyl transferase and using a poly t primer to amplify the product of the cdna synthesis but of course i would have to sequence the pcr product generated this is not a problem its just an extra step which if i can i would like to avoid i welcome any comments suggestions or alternative methods and would post a summary if one is requested robert delisio previous message dig fun pressure sensitive membranes next message serine protease substrates a summary messages sorted by more information about the methods...
*  PPG Waterborne Primer Surfacer In Action - Rod & Custom Magazine
PPG Waterborne Primer Surfacer In Action - Rod Custom Magazine. HOTROD. CAR CRAFT. STREET RODDER. ENGINE MASTERS. HOT ROD DELUXE. MUSCLE CAR REVIEW. Engine. Videos. Hot Rod Garage. All Videos. Street Rodder Road Tour. Engine Masters Challenge. Hot Rod LIVE. Subscribe. Facebook. Twitter. Google+. PPG Waterborne Primer Surfacer - Primed and Ready for Action. PPG Waterborne Primer Surfacer - Primed and Ready for Action. {{item.title}}. Street Rodder. PPG Waterborne Primer Surfacer - Primed and Ready for Action Written by. Shooting PPG’s Revolutionary Waterborne Primer Surfacer. Facebook. Twitter. Google+. At the time we hinted at PPG’s next release: a waterborne primer. It refers to it as Waterborne Speed Prime PN EPW115 primer surfacer. At the time Charley Hutton was using it as a surfacer over prepared panels primers and existing painted surfaces. Try that with 2K primers and you’ll end up with an expensive paperweight. Then PPG went and did something totally unexpected: it announced that EPW115 can be applied...
*  Design your primers using PrimerBase 1.0
design your primers using primerbase design your primers using primerbase chang zhu czhu at hotmail com sun feb est previous message control your own future next message messages sorted by primerbase is a small database for storing searching and designing of oligo nucleotides it provides users with many convenient functions primer design finds primers or primer pairs with optimal annealing temperature and gc content check for primer primer dimers database stores primer information in an searchable database searching searches primers in both directions using target sequences all for only give it a try by downloading at http www geocities com virtualab primerbase primerbase html previous message control your own future next message messages sorted by more information about the ag forst mailing list...
T3/T7 PRIMER QUESTION!!. T3/T7 PRIMER QUESTION!!. Darren Stauth stauth at crunch.usgmrl.ksu.edu. Thu Nov 3 12:19:51 EST 1994. Previous message: Luciferase sensitive to dilution Next message: T3/T7 PRIMER QUESTION!!. Messages sorted by:. I'm currently doing universal PCR to amplify and sequence an unknown region of DNA. I've used a couple of different universal primers, both of which contain T7 primer sequence but found they caused problems because the TA cloning vector also contains a T7 site. This gives mixed sequence when performing sequencing reactions with the T7 primer. So we changed to a uni-primer with a T3 site within it. By some confusion I used T7 instead of T3 in my second round of PCR yet still got amplification. I assume since T7 and T3 are so similar that T7 misannealed to the T3 site. This leads me to my question: since T7 and T3 are so similar and can misanneal to give amplification in PCR, will the same thing happen in sequencing reactions. I've seen vectors containing both T7 and T3 sites. H...
*  OriGene - POU5F2 (NM 153216) qPCR Primer Pair
origene pou f nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair pou f gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - LAMP1 (NM 005561) qPCR Primer Pair
origene lamp nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair lamp gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Pou4f2 (NM 138944) qPCR Primer Pair
OriGene - Pou4f2 NM 138944 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. Pou4f2 Gene ID 18997 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - JAG1 (NM 000214) qPCR Primer Pair
OriGene - JAG1 NM 000214 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. JAG1 Gene ID 182 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - RAB1A (NM 004161) qPCR Primer Pair
origene rab a nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair rab a gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - RPS13 (NM 001017) qPCR Primer Pair
OriGene - RPS13 NM 001017 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. RPS13 Gene ID 6207 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - HSP90AB1 (NM 007355) qPCR Primer Pair
origene hsp ab nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair hsp ab gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - FAM107B (NM 031453) qPCR Primer Pair
OriGene - FAM107B NM 031453 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. FAM107B Gene ID 83641 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - PTEN (NM 000314) qPCR Primer Pair
OriGene - PTEN NM 000314 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. PTEN Gene ID 5728 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations 1 Related Products Product Documents....
*  OriGene - BRAF (NM 004333) qPCR Primer Pair
origene braf nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair braf gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Myh9 (NM 022410) qPCR Primer Pair
origene myh nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair myh gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - UNG (NM 080911) qPCR Primer Pair
OriGene - UNG NM 080911 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. UNG Gene ID 7374 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - VASP (NM 003370) qPCR Primer Pair
origene vasp nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair vasp gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - PIK3CG (NM 002649) qPCR Primer Pair
OriGene - PIK3CG NM 002649 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. PIK3CG Gene ID 5294 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations 1 Related Products Product Documents....
*  OriGene - FABP2 (NM 000134) qPCR Primer Pair
origene fabp nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair fabp gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - ABCB8 (NM 007188) qPCR Primer Pair
origene abcb nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair abcb gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Gdf3 (NM 008108) qPCR Primer Pair
origene gdf nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair gdf gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - KRT1 (NM 006121) qPCR Primer Pair
origene krt nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair krt gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - PML (NM 033238) qPCR Primer Pair
origene pml nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair pml gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Tuba1c (NM 009448) qPCR Primer Pair
origene tuba c nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair tuba c gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - NOS2 (NM 000625) qPCR Primer Pair
origene nos nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair nos gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - BAD (NM 004322) qPCR Primer Pair
origene bad nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair bad gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - S1PR2 (NM 004230) qPCR Primer Pair
origene s pr nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair s pr gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - CCL18 (NM 002988) qPCR Primer Pair
origene ccl nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair ccl gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - TG (NM 003235) qPCR Primer Pair
origene tg nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair tg gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - ESR2 (NM 001437) qPCR Primer Pair
OriGene - ESR2 NM 001437 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. ESR2 Gene ID 2100 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - LAMB2 (NM 002292) qPCR Primer Pair
origene lamb nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair lamb gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - MAGEB1 (NM 002363) qPCR Primer Pair
origene mageb nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair mageb gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - ZBP1 (NM 030776) qPCR Primer Pair
OriGene - ZBP1 NM 030776 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. ZBP1 Gene ID 81030 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - VTI1A (NM 145206) qPCR Primer Pair
origene vti a nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair vti a gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - GPHN (NM 020806) qPCR Primer Pair
origene gphn nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair gphn gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - KATNAL1 (NM 032116) qPCR Primer Pair
OriGene - KATNAL1 NM 032116 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. KATNAL1 Gene ID 84056 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - PSEN1 (NM 000021) qPCR Primer Pair
origene psen nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair psen gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - CHRNA1 (NM 000079) qPCR Primer Pair
origene chrna nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair chrna gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - HBA1 (NM 000558) qPCR Primer Pair
origene hba nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair hba gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - CPB2 (NM 001872) qPCR Primer Pair
origene cpb nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair cpb gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - DBT (NM 001918) qPCR Primer Pair
origene dbt nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair dbt gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - NAA10 (NM 003491) qPCR Primer Pair
OriGene - NAA10 NM 003491 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. NAA10 Gene ID 8260 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - EEA1 (NM 003566) qPCR Primer Pair
origene eea nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair eea gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - BST2 (NM 004335) qPCR Primer Pair
origene bst nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair bst gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - CALR (NM 004343) qPCR Primer Pair
OriGene - CALR NM 004343 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. CALR Gene ID 811 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - HABP4 (NM 014282) qPCR Primer Pair
OriGene - HABP4 NM 014282 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. HABP4 Gene ID 22927 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - SETBP1 (NM 015559) qPCR Primer Pair
origene setbp nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair setbp gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - WDR55 (NM 017706) qPCR Primer Pair
OriGene - WDR55 NM 017706 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. WDR55 Gene ID 54853 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - HACE1 (NM 020771) qPCR Primer Pair
origene hace nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair hace gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - WDFY1 (NM 020830) qPCR Primer Pair
origene wdfy nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair wdfy gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - PDZD3 (NM 024791) qPCR Primer Pair
origene pdzd nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair pdzd gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - PAAF1 (NM 025155) qPCR Primer Pair
OriGene - PAAF1 NM 025155 qPCR Primer Pair. My Account. Shopping Cart. Home. 中文 Search:. Gene Expression TissueScan qPCR Array qPCR Arrays for mRNA RNA/DNA from Cancer Tissues SYBR Green Master Mix RNA Purification Kit 1st Strand cDNA Synthesis Kit First Strand cDNA. Related Products Over Expression cDNA Clones RNAi Cancer Tissues Antibodies Multiplex Assays. Useful Links Audio Slideshow Clone Brochure Recent Citations. Home qPCR qPCR Primer Pair. PAAF1 Gene ID 80227 qPCR Primer Pairs. To view the qPCR Primer sequence, please register your email:. Email:. Specifications Citations Related Products Product Documents....
*  OriGene - CACNG6 (NM 145814) qPCR Primer Pair
origene cacng nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair cacng gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Acan (NM 007424) qPCR Primer Pair
origene acan nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair acan gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Alb (NM 009654) qPCR Primer Pair
origene alb nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair alb gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Crxos (NM 001033638) qPCR Primer Pair
origene crxos nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair crxos gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  OriGene - Jade3 (NM 199317) qPCR Primer Pair
origene jade nm qpcr primer pair my account shopping cart home 中文 search gene expression tissuescan qpcr array qpcr arrays for mrna rna dna from cancer tissues sybr green master mix rna purification kit st strand cdna synthesis kit first strand cdna related products over expression cdna clones rnai cancer tissues antibodies multiplex assays useful links audio slideshow clone brochure recent citations home qpcr qpcr primer pair jade gene id qpcr primer pairs to view the qpcr primer sequence please register your email email specifications citations related products product documents...
*  [Bioperl-l] Primer maps?
Sean Davis sdavis2 at mail.nih.gov. Previous message: Primer maps. Messages sorted by:. Do you mean that you want to use Bio::Graphics to make a picture, or just map your primers onto a sequence. Sean On 2/15/06 4:20 PM, Michael Coyne mcoyne at channing.harvard.edu wrote: Hello all -- I'm having a devil of a time figuring out how to make restriction maps using BioPerl. What I'm going for is output similar to GCG's map program, but instead of using a set of defined restriction enzymes, I'd like to use a set of primers, to create a primer map rather than a restriction map. I do not need a table of restriction enzymes that cut or don't cut or primers that match or don't match, in this case, but an honest-to-goodness map, something like: FKP-5- CGTTCTATCGATATGGGTGCTATGGAAATAGTATCTACGTTTGATGAATTGCAAGATTAT 1921 ---------+---------+---------+---------+---------+---------+ 1980 GCAAGATAGCTATACCCACGATACCTTTATCATAGATGCAAACTACTTAACGTTCTAATA a M E I V S T F D E L Q D Y - I also need translations of orfs, but I can use Ge...
*  The Treatment Showdown : CDC Toolkit vs IACFS/ME Primer
... July 24, 2012. The CDC does not believe any symptoms warrant further tests even though many presenting with a possible diagnosis will have other disorders. CDC Toolkit no recommendations IACFS/ME Primer provides dietary advice, no advice on drugs DIET. Cort July 24, 2012, 10:59 am Thanks Denise I was astonished at how sparse the CDC Toolkit was The conception the authors of the Toolkit probably CDC staff and the authors of the Treatment Primer ME/CFS physicians have of ME/CFS treatment is miles apart .It almost couldn t be wider. WillowJ July 24, 2012, 4:42 pm It might be useful to note that the CDC does not actually define post-exertional malaise. I do think they still need to go A LOT further in some things even if it is only a primer as a primer needs to be ALSO suitable for those who are more severe cases and have many other symptoms too from this illness which actually need treatment. Firestormm July 25, 2012, 5:19 pm Can I ask how this will/might be affected by the Physicians Guide to the Internati...
*  Needing a primer on batteries
... Welcome, Guest. Please login or register. CanonRumors. Forum Home. Help. Search. Login. Register. October 07, 2015, 12:45:04 AM. canon rumors FORUM. Gear Talk. Software Accessories. Needing a primer on batteries. . previous next Print. Pages: 2. Author Topic: Needing a primer on batteries Read 6574 times. EOBeav Canon 6D. Posts: 414. Needing a primer on batteries on: October 07, 2012, 01:10:24 PM. I need to get a 2nd battery for my 5DmkII. The problem is, I don t know what a better deal is, the original Canon that sells for $50USD+, or an off-brand with similar specs that sells for $35USD. Logged In landscape photography, when you shoot is more important than where. Gear: Canon 5DmkII, 17-40mm f/4 L, 50mm f/1.4, 70-200mm f/4. canon rumors FORUM. Needing a primer on batteries on: October 07, 2012, 01:10:24 PM. neuroanatomist CR GEEK. Posts: 17033. . Re: Needing a primer on batteries Reply #1 on: October 07, 2012, 01:21:53 PM. Depends on the off-brand. Some are fine, others don t deliver the mAh capacity t...
*  PCR failing
... Irit Rappley via methods%40net.bio.net by irappley from scripps.edu Fri Apr 9 11:18:23 EST 2010. Previous message: PCR failing Next message: PCR failing Messages sorted by:. You could also try getting the 260/280 reading for your DNA in a spectrophotometer to make sure it's relatively pure you want a ratio of 1.8-2.0. While you're at it, use the 260 reading to check the concentration of your DNA prep. I had a similar situation with a PCR that suddenly stopped working for a technician, and in the end I had to take over the troubleshooting myself to figure it out. Irit On Apr 9, 2010, at 3:20 AM, Peter Ellis wrote: On Fri, 9 Apr 2010, LeboMad wrote: Hey Duncan thanks for the response. New batch of primers, new batch. of DNA extraction reagents, new batch of enzyme / buffer / NTPs. I would try the following: 1 Positive control PCR with a known good primer pair + template, to confirm that the enzyme / buffers / nucleotides are OK. don't know if those primers are working OK. If the enzyme / buffers / nucleoti...
*  PCR primers for mapping
... bosborne at insect berkeley edu bosborne at insect berkeley edu mon feb est previous message pcr for mapping purposes next message constitutive clone messages sorted by to the group i m in the process of assigning t dna flanking regions to the genetic map using ri lines courtesy of c dean i have experience with the same procedure in tomato using southern blotting and i d like to use an alternative approach such as sspg or pcr with or without restriction enzyme cleavage does anyone have the sequence of pcr primers corresponding to previously mapped goodman or meyerowitz clones where the products distinguish the col o and ler parents these primers would be used as positive controls in the mapping thanks for your attention to this matter brian osborne plant gene expression center bosborne at insect berkeley edu albany ca usa previous message pcr for mapping purposes next message constitutive clone messages sorted by more information about the arab gen mailing list...
*  primers problem
... wolfgang schechinger marsupilamiwolfgang at pop web de fri feb est previous message primers problem next message primers problem messages sorted by edta could affect those enzymes liking bivalent cations like mg as well you introduce a buffering substance tris into the system for me water does the job pretty well all the best wolfgang hi tina i always resuspend oligos at about m in te ph then aliqout and store at c tim this message is encrypted use your brain to decode it dr wolfgang schechinger institute of biomedical sciences academia sinica taipei taiwan r o c previous message primers problem next message primers problem messages sorted by more information about the methods mailing list...
*  The Firing Line Forums - View Single Post - I de-capped some live primers, now what?
the firing line forums view single post i de capped some live primers now what thread i de capped some live primers now what view single post april pm hgmeyer senior member join date february location elgin il posts disposing of live primers sinking them in oil may not de activate the primer depends on brand etc some testing results were posted on predatormasters responding to a thread about the subject seems that wd oil acetone and a whole lot of other stuff did not fully deactivate the primers suggestion was to seat them if possible in an empty case and pop them off if possible hgmeyer view public profile find more posts by hgmeyer page generated in seconds with queries...
*  www.biomedcentral.com - Table
www biomedcentral com table table pcr primer pairs used amplify ccsp and β actin cdna fragments of beas b cells target oligonucleotide sequence tm c bp ccsp f gaaactcgctgtcaccctcacc r ttaatgatgctttctctgg β actin f cctgtacgccaacacagtgc r atactcctgcttgctgatcc f forward primer r reverse primer tm melting temperature shiyu et al bmc cell biology doi...
*  PCR Using T7 and SP6 Primers
pcr using t and sp primers pcr using t and sp primers ted tedm at spam darkwing uoregon edu wed jul est previous message blunt end ligation and peg next message pcr product stuck in well messages sorted by pcr efficiency is somewhat unimportant when amplifying a plasmid eh t has worked fine with a c anneal in my hands and with so much template you could probably just go cycles these so called pcr southerns are just a binary assay either its there or its not regards ted michelini uo previous message blunt end ligation and peg next message pcr product stuck in well messages sorted by more information about the methods mailing list...
*  Uncategorized templates - D&D Wiki
Uncategorized templates - D D Wiki. Uncategorized templates. From D D Wiki. Jump to: navigation, search Showing below up to 50 results in range # 1 to # 50. View previous 50. next 50 20. 50. 100. 250. 500. Template:!!/doc Template:!/doc Template:1 Template:1/2 Template:1/3 Template:2 Template:2.5e Breadcrumb Template:2.5e Character Options Breadcrumb Template:2.5e Classes Breadcrumb Template:2.5e Complex Special Ability Components Breadcrumb Template:2.5e Creature Template:2.5e Creatures Breadcrumb Template:2.5e Flaws Breadcrumb Template:2.5e Mage Spells Breadcrumb Template:2.5e Races Breadcrumb Template:2.5e Spell Template:2.5e Traits Breadcrumb Template:3 Template:3.5 D20 High School Setting Breadcrumb Template:3.5e Adventuring Gear Breadcrumb Template:3.5e Alternate Class Feature Template:3.5e Alternate Class Features Breadcrumb Template:3.5e Andu Setting Breadcrumb Template:3.5e Arcane Feats Breadcrumb Template:3.5e Archivist Alternate Class Features Breadcrumb Template:3.5e Artifact Template:3.5e Barbari...
*  Unused templates - waze
Live Map Major Events Support Blog About Unused templates From waze Jump to: navigation, search This page lists all pages in the Template namespace that are not included in another page. Remember to check for other links to the templates before deleting them. Showing below up to 50 results in range # 1 to # 50 . View (previous 50 | next 50 ) ( 20 | 50 | 100 | 250 | 500 ) Template:*/doc ‏‎ ( other links ) Template:AM ‏‎ ( other links ) Template:AM/Area2Link ‏‎ ( other links ) Template:AboutThisPage Navbox/doc ‏‎ ( other links ) Template:Adicionando Postos de Gasolina ‏‎ ( other links ) Template:As of/doc/TemplateData ‏‎ ( other links ) Template:Atalhos de teclado para WME ‏‎ ( other links ) Template:BE DE ‏‎ ( other links ) Template:BE Title ‏‎ ( other links ) Template:Benelux Navigator ‏‎ ( other links ) Template:Benelux NavigatorContent ‏‎ ( other links ) Template:Benelux Skin ‏‎ ( other links ) Template:Benelux Title ‏‎ ( other links ) Template:Blue/doc ‏‎ ( other links ) Template:Box-header/1 ‏‎ ( other li...
*  Fixed #12787: Correctly identify the template that does not exist whe… · django/django@80e7449 ·
... GitHub. Skip to content. Sign up Sign in. This repository. Explore. Features. Enterprise. Pricing. Watch. 889. Star. 16,210. Fork. 6,537. django. / django. Code Pull requests. Pulse Graphs HTTPS clone URL. Subversion checkout URL. You can clone with. . HTTPS or. . Subversion. Download ZIP. Permalink. Browse files Fixed #12787: Correctly identify the template that does not exist whe…. …n a template being extended includes another template that does not exist. Thanks to trigeek38 for the report. git-svn-id: http://code.djangoproject.com/svn/django/trunk@12792 bcc190cf-cafb-0310-a4f2-bffc1f526a37. Loading branch information ... commit 80e744945c4d6c16c820fe0671b36654ca484e43. 1 parent e89a5e0. kmtracey authored Mar 16, 2010. Unified. Split. Showing 6 changed files with 121 additions and 40 deletions. +9. −2.     . django/template/loader.py. +1. −4.     . django/template/loader tags.py. +8. −1.    ...
*  Template:Template category
template template category template template category onright cmbox type notice style padding bottom em image px template braces alt link text ifaffirmed note please do not add templates to this category instead use one of its subcategories if topic if topic switch lc navbox navigation navigational infobox sidebar ucfirst templates default templates relating to if the pages listed in this category are meant to be switch lc type ambox article message box ambox templates campaignbox campaignbox templates conversion templates that perform conversions external link templates providing external links formatting templates that provide formatting function function templates nobold i e templates that produce text images or other elements infobox infobox templates meta metatemplates navigation navigational navbox navigation templates sidebar sidebar templates stub stub templates sub subtemplates timeline timeline templates userbox userbox templates default templates the pages listed in this category are templates this...
*  Template:Template category/sandbox
template template category sandbox template template category sandbox onright cmbox type notice style padding bottom em image px template braces alt link text ifaffirmed note please do not add templates to this category instead use one of its subcategories if topic if topic switch lc navbox navigation navigational infobox sidebar ucfirst templates default templates relating to if the pages listed in this category are meant to be switch lc type ambox article message box ambox templates campaignbox campaignbox templates conversion templates that perform conversions external link templates providing external links formatting templates that provide formatting function function templates nobold i e templates that produce text images or other elements infobox infobox templates meta metatemplates navigation navigational navbox navigation templates sidebar sidebar templates stub stub templates sub subtemplates timeline timeline templates userbox userbox templates default templates the pages listed in this category ar...
*  Medical Stretched Flash E-commerce CMS Templates - Ozzu
... 1 Flash CMS Templates and counting. Medical Stretched Flash E-commerce CMS Templates. Medical professionals, doctors, nurses, health care providers, pharmaceutical suppliers, medical equipment manufacturers. All of them can utilize these medical flash cms templates. If your company provides vitamins and supplements, stethoscopes, medical supplies, nutrition information, or anything else related to medicine, you should get back to helping people as you love to do, and let one of these medical flash cms templates make your website better today. Our Stretched Flash Ecommerce CMS templates enable users to edit Flash websites and Flash content by using a WYSIWYG editor and built-in image editor. Our stretched templates or liquid templates are entirely flexible, filling the browser window as it expands or contracts. With these Stretched Flash Ecommerce CMS designs you can avoid having to use Adobe Flash editor to edit the source .fla files. You can update and save everything on-the-fly. Our Flash content manag...
*  Hermes's Medical Zen Cart Templates - Ozzu
... 6 Zen Cart Templates and counting. Hermes's Medical Zen Cart Templates. All 6 templates in this section were created by our web designer Hermes. Medical professionals, doctors, nurses, health care providers, pharmaceutical suppliers, medical equipment manufacturers. All of them can utilize these medical zen cart templates. If your company provides vitamins and supplements, stethoscopes, medical supplies, nutrition information, or anything else related to medicine, you should get back to helping people as you love to do, and let one of these medical zen cart templates make your website better today. Zen Cart is an open source online store management system that you can use to easily run your own online store. Our Zen Cart templates provide you with the simplest solution in setting up your own e-commerce store. Features are very similiar to that of osCommerce including an ad banner controller, shipping options, multiple payment options, newsletter manager, discount coupons, gift certificates, featured prod...
*  Business Download Template - Business
... Templates / Flash. Template downloads in business. Template For Ebook Minisite Template For Marketing Needs. Template For Ebook Minisite Template For Marketing Needs If you are in the following businesses: template for ebook minisite template column template...... Download. 7.99 USD. X The seller chris49 offers you 10.0% on each sale. Download. 68.95 USD. X The seller quickstubs offers you 10.0% on each sale. Gt5 - Oscommerce Template - Grey And Olive. Download. 12 USD. X The seller gomeza offers you 10.0% on each sale. Gt5 - Oscommerce Template - Burgundy And Gold. Download. 12 USD. X The seller gomeza offers you 10.0% on each sale. Black History Website Template, Comes With Plr. Download Preview. 3.49 USD. X The seller soltun699 offers you 10.0% on each sale. Download Preview. 3.49 USD. X The seller soltun699 offers you 10.0% on each sale. Auction Template Creator, Mrr/giveaway. "Easily Create Auction Listing Templates PROVEN To Get Results..." Step By Step Theme Based Auction Template Creation Softwar...
*  GFashion - Responsive Online Shop Template - Site Templates | ThemeForest
GFashion - Responsive Online Shop Template - Site Templates. ThemeForest. Envato Market ThemeForest. CodeCanyon. Search. Popular Files. Featured Files. Top New Files. Follow Feed. Top Authors. Top New Authors. WordPress Popular Items. Blog / Magazine. Corporate. Creative. eCommerce. Entertainment. Mobile. Nonprofit. Retail. Technology. Wedding. Miscellaneous. WordPress Plugins on CodeCanyon. HTML Popular Items. Admin Templates. Corporate. Creative. Entertainment. Mobile. Nonprofit. Personal. Retail. Technology. Wedding. Miscellaneous. Marketing Popular Items. Email Templates. Landing Pages. Unbounce Landing Pages. Google Web Designer Ads on CodeCanyon. CMS Popular Items. Drupal. MODX Themes. Miscellaneous. eCommerce Popular Items. Cart66. CS-Cart. Drupal Commerce. OpenCart. Ubercart. WP e-Commerce. Zen Cart. Miscellaneous. PSD Popular Items. Corporate. Creative. Entertainment. Nonprofit. Personal. Retail. Technology. Miscellaneous. Ghost Themes Layers WP About Layers WP. Layers WP Child Themes. Layers WP Exte...
*  Newstick Responsive News & Magazine Template - Site Templates | ThemeForest
Newstick Responsive News Magazine Template - Site Templates. Envato Market ThemeForest. Popular Files. Featured Files. Top New Files. Follow Feed. Top Authors. Top New Authors. WordPress Popular Items. Blog / Magazine. Corporate. Creative. Retail. Technology. Miscellaneous. WordPress Plugins on CodeCanyon. HTML Popular Items. Admin Templates. Corporate. Creative. Nonprofit. Personal. Miscellaneous. Marketing Popular Items. Email Templates. Landing Pages. CMS Popular Items. Miscellaneous. eCommerce Popular Items. WP e-Commerce. Miscellaneous. PSD Popular Items. Corporate. Creative. Entertainment. Nonprofit. Personal. Retail. Technology. Miscellaneous. Ghost Themes Layers WP About Layers WP. Layers WP Child Themes. Layers WP Extensions. Layers WP Style Kits. Muse Popular Items. Corporate. Creative. Landing. Personal. Newstick Responsive News Magazine Template Newstick Responsive News Magazine Template. Newstick is a responsive site template that has clean and elegant design for blog template. Bulit with bootstr...
*  Free Hospital Strategic Plan Template Downloads: COPD Evaluation Short Template by e-MedTools, Asthm
... a Evaluation Template by e-MedTools and More. Menu Home. New Software. Top Software. Top Search. Submit Software. RSS. Contact. Categories Business Desktop Internet Development Multimedia Games Utilities. Categories. Business. Desktop. Development. Education. Games. Home Personal. Internet. Mobile. Multimedia. Security Privacy. Utilities. Web Development. New Software. dbExpress driver for SQL Server. USB Guardian. 2D Barcode FMX Components. Nero SoundTrax. AD Browser. Icecream Screen Recorder. Advanced CSV Converter. Inscriptio. uTorrent SpeedUp Pro. BitTorrent PRO. Recovery Toolbox for PowerPoint. ClickCharts FlowCharts Free for... Jolix MP3 Recorder. Tessera. AOMEI Partition Assistant... Attribute Manager. BearShare Turbo. Top Software. 7-Zip. Paragon Hard Disk Manager. TuneUp Utilities 2014. doPDF free PDF creator. LibreOffice. avast. Antivirus. Revo Uninstaller Free. Postbox. Fences. Sendtosendto. VirtuaWin. Bitdefender Internet Security 2014. TinyWall. NaviFirm Plus. Nokia PC Suite. FBackup free bac...

Symmetry element: A symmetry element is a point of reference about which symmetry operations can take place. In particular, symmetry elements can be centers of inversion, axes of rotation and mirror planes.Raphidiophrys contractilisDeoxyguanosine triphosphateColes PhillipsThermal cyclerT7 DNA polymerase: T7 DNA polymerase is an enzyme used during the DNA replication of the T7 bacteriophage. During this process, the DNA polymerase “reads” existing DNA strands and creates two new strands that match the existing ones.YjdF RNA motifDNA condensation: DNA condensation refers to the process of compacting DNA molecules in vitro or in vivo. Mechanistic details of DNA packing are essential for its functioning in the process of gene regulation in living systems.DNA re-replication: DNA re-replication (or simply rereplication) is an undesirable and possibly fatal occurrence in eukaryotic cells in which the genome is replicated more than once per cell cycle. Rereplication is believed to lead to genomic instability and has been implicated in the pathologies of a variety of human cancers.Telomerase: Telomerase also called telomere terminal transferaseWhat are telomeres and telomerase? is a ribonucleoprotein that adds the polynucleotide "TTAGGG" to the 3' end of telomeres, which are found at the ends of eukaryotic chromosomes.Sticky and blunt ends: DNA end or sticky end refers to the properties of the end of a molecule of DNA or a recombinant DNA molecule. The concept is important in molecular biology, especially in cloning or when subcloning inserts DNA into vector DNA.Klenow fragmentNucleic acid structure: Nucleic acid structure refers to the structure of nucleic acids such as DNA and RNA. Chemically speaking, DNA and RNA are very similar.NTP binding site: An NTP binding site is a type of binding site found in nucleoside monophosphate (NMP) kinases, N can be adenosine or guanosine. A P-loop is one of the structural motifs common for nucleoside triphosphate (NTP) binding sites, it interacts with the bound nucleotide's phosphoryl groups.Specificity constant: In the field of biochemistry, the specificity constant (also called kinetic efficiency or k_{cat}/K_{M}), is a measure of how efficiently an enzyme converts substrates into products. A comparison of specificity constants can also be used as a measure of the preference of an enzyme for different substrates (i.Discovery and development of nucleoside and nucleotide reverse-transcriptase inhibitors: Discovery and development of nucleoside and nucleotide reverse-transcriptase inhibitors (NRTIs and NtRTIs) began in the 1980s when the AIDS epidemic hit Western societies. NRTIs inhibit the reverse transcriptase (RT), an enzyme that controls the replication of the genetic material of the human immunodeficiency virus (HIV).Burst kinetics: Burst kinetics is a form of enzyme kinetics that refers to an initial high velocity of enzymatic turnover when adding enzyme to substrate. This initial period of high velocity product formation is referred to as the "Burst Phase".Silent mutation: Silent mutations are mutations in DNA that do not significantly alter the phenotype of the organism in which they occur. Silent mutations can occur in non-coding regions (outside of genes or within introns), or they may occur within exons.DNA binding site: DNA binding sites are a type of binding site found in DNA where other molecules may bind. DNA binding sites are distinct from other binding sites in that (1) they are part of a DNA sequence (e.List of strains of Escherichia coli: Escherichia coli is a well studied bacterium that was first identified by Theodor Escherich, after whom it was later named.Vpx: Vpx is a virion-associated protein encoded by human immunodeficiency virus type 2 HIV-2 and most simian immunodeficiency virus (SIV) strains, but that is absent from HIV-1. It is similar in structure to the protein Vpr that is carried by SIV and HIV-2 as well as HIV-1.DNA sequencer: A DNA sequencer is a scientific instrument used to automate the DNA sequencing process. Given a sample of DNA, a DNA sequencer is used to determine the order of the four bases: G (guanine), C (cytosine), A (adenine) and T (thymine).RAPD: RAPD (pronounced "rapid") stands for 'Random Amplified Polymorphic DNA'. It is a type of PCR reaction, but the segments of DNA that are amplified are random.Assay sensitivity: Assay sensitivity is a property of a clinical trial defined as the ability of a trial to distinguish an effective treatment from a less effective or ineffective intervention. Without assay sensitivity, a trial is not internally valid and is not capable of comparing the efficacy of two interventions.Ligation-independent cloning: Ligation-independent cloning (LIC) is a form of molecular cloning that is able to be performed without the use of restriction endonucleases or DNA ligase. This allows genes that have restriction sites to be cloned without worry of chopping up the insert.Branching order of bacterial phyla (Gupta, 2001): There are several models of the Branching order of bacterial phyla, one of these was proposed in 2001 by Gupta based on conserved indels or protein, termed "protein signatures", an alternative approach to molecular phylogeny. Some problematic exceptions and conflicts are present to these conserved indels, however, they are in agreement with several groupings of classes and phyla.Protein primary structure: The primary structure of a peptide or protein is the linear sequence of its amino acid structural units, and partly comprises its overall biomolecular structure. By convention, the primary structure of a protein is reported starting from the amino-terminal (N) end to the carboxyl-terminal (C) end.Amplified Ribosomal DNA Restriction Analysis: Amplified rDNA (Ribosomal DNA) Restriction Analysis is the extension of the technique of RFLP (restriction fragment length polymorphism) to the gene encoding the small (16s) ribosomal subunit of bacteria. The technique involves an enzymatic amplification using primers directed at the conserved regions at the ends of the 16s gene, followed by digestion using tetracutter Restriction enzymes.Eukaryotic transcription: Eukaryotic transcription is the elaborate process that eukaryotic cells use to copy genetic information stored in DNA into units of RNA replica. Gene transcription occurs in both eukaryotic and prokaryotic cells.Primase: DNA primase, also called as DNA primerase, is an enzyme involved in the replication of DNA. DNA primase is a type of RNA polymerase which creates an RNA primer (later this RNA piece is removed by a 5' to 3' exonuclease); next, DNA polymerase uses the RNA primer to replicate ssDNA.Poly(methacrylic acid)Polymerase-endonuclease amplification reaction: Polymerase-endonuclease amplification reaction (PEAR) is a DNA amplification technology for the amplification of oligonucleotides. A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease (PspGI) cleavage releases monomeric duplex oligonucleotides.CS-BLASTAbscription: During normal transcription, RNA polymerase transcribes a number of short nonproductive oligonucleotides, and this process is called abortive transcription. The trapped RNAPs have been named abscriptases and the synthesis of specific length oligonucleotides called abscription.Allele-specific oligonucleotide: An allele-specific oligonucleotide (ASO) is a short piece of synthetic DNA complementary to the sequence of a variable target DNA. It acts as a probe for the presence of the target in a Southern blot assay or, more commonly, in the simpler Dot blot assay.PolymeraseMature messenger RNA: Mature messenger RNA, often abbreviated as mature mRNA is a eukaryotic RNA transcript that has been spliced and processed and is ready for translation in the course of protein synthesis. Unlike the eukaryotic RNA immediately after transcription known as precursor messenger RNA, it consists exclusively of exons, with all introns removed.Microsatellite: A microsatellite is a tract of repetitive DNA in which certain DNA motifs (ranging in length from 2–5 base pairs) are repeated, typically 5-50 times. Microsatellites occur at thousands of locations in the human genome and they are notable for their high mutation rate and high diversity in the population.Transfer-messenger RNA: Transfer-messenger RNA (abbreviated tmRNA, also known as 10Sa RNA and by its genetic name SsrA) is a bacterial RNA molecule with dual tRNA-like and messenger RNA-like properties. The tmRNA forms a ribonucleoprotein complex (tmRNP) together with Small Protein B (SmpB), Elongation Factor Tu (EF-Tu), and ribosomal protein S1.Amplified fragment length polymorphismGenetic variation: right|thumbBagnold's fluid: Bagnold's fluid refers to a suspension of neutrally buoyant particles in a Newtonian fluid such as water or air. The term is named after Ralph Alger Bagnold, who placed such a suspension in an annular coaxial cylindrical rheometer in order to investigate the effects of grain interaction in the suspension.Ferric uptake regulator family: In molecular biology, the ferric uptake regulator (FUR) family of proteins includes metal ion uptake regulator proteins. These are responsible for controlling the intracellular concentration of iron in many bacteria.Gene polymorphismCommunity Fingerprinting: Community fingerprinting refers to a set of molecular biology techniques that can be used to quickly profile the diversity of a microbial community. Rather than directly identifying or counting individual cells in an environmental sample, these techniques show how many variants of a gene are present.Library (biology): In molecular biology, a library is a collection of DNA fragments that is stored and propagated in a population of micro-organisms through the process of molecular cloning. There are different types of DNA libraries, including cDNA libraries (formed from reverse-transcribed RNA), genomic libraries (formed from genomic DNA) and randomized mutant libraries (formed by de novo gene synthesis where alternative nucleotides or codons are incorporated).CpG Oligodeoxynucleotide

(1/43244) Activation of systemic acquired silencing by localised introduction of DNA.

BACKGROUND: In plants, post-transcriptional gene silencing results in RNA degradation after transcription. Among tobacco transformants carrying a nitrate reductase (Nia) construct under the control of the cauliflower mosaic virus 35S promoter (35S-Nia2), one class of transformants spontaneously triggers Nia post-transcriptional gene silencing (class II) whereas another class does not (class I). Non-silenced plants of both classes become silenced when grafted onto silenced stocks, indicating the existence of a systemic silencing signal. Graft-transmitted silencing is maintained in class II but not in class I plants when removed from silenced stocks, indicating similar requirements for spontaneous triggering and maintenance. RESULTS: Introduction of 35S-Nia2 DNA by the gene transfer method called biolistics led to localised acquired silencing (LAS) in bombarded leaves of wild-type, class I and class II plants, and to systemic acquired silencing (SAS) in class II plants. SAS occurred even if the targeted leaf was removed 2 days after bombardment, indicating that the systemic signal is produced, transmitted and amplified rapidly. SAS was activated by sense, antisense and promoterless Nia2 DNA constructs, indicating that transcription is not required although it does stimulate SAS. CONCLUSIONS: SAS was activated by biolistic introduction of promoterless constructs, indicating that the DNA itself is a potent activator of post-transcriptional gene silencing. The systemic silencing signal invaded the whole plant by cell-to-cell and long-distance propagation, and reamplification of the signal.  (+info)

(2/43244) Impaired translesion synthesis in xeroderma pigmentosum variant extracts.

Xeroderma pigmentosum variant (XPV) cells are characterized by a cellular defect in the ability to synthesize intact daughter DNA strands on damaged templates. Molecular mechanisms that facilitate replication fork progression on damaged DNA in normal cells are not well defined. In this study, we used single-stranded plasmid molecules containing a single N-2-acetylaminofluorene (AAF) adduct to analyze translesion synthesis (TLS) catalyzed by extracts of either normal or XPV primary skin fibroblasts. In one of the substrates, the single AAF adduct was located at the 3' end of a run of three guanines that was previously shown to induce deletion of one G by a slippage mechanism. Primer extension reactions performed by normal cellular extracts from four different individuals produced the same distinct pattern of TLS, with over 80% of the products resulting from the elongation of a slipped intermediate and the remaining 20% resulting from a nonslipped intermediate. In contrast, with cellular extracts from five different XPV patients, the TLS reaction was strongly reduced, yielding only low amounts of TLS via the nonslipped intermediate. With our second substrate, in which the AAF adduct was located at the first G in the run, thus preventing slippage from occurring, we confirmed that normal extracts were able to perform TLS 10-fold more efficiently than XPV extracts. These data demonstrate unequivocally that the defect in XPV cells resides in translesion synthesis independently of the slippage process.  (+info)

(3/43244) Overexpression of CuZn superoxide dismutase protects RAW 264.7 macrophages against nitric oxide cytotoxicity.

Initiation of nitric oxide (NO.)-mediated apoptotic cell death in RAW 264.7 macrophages is associated with up-regulation of mitochondrial manganese superoxide dismutase (MnSOD; SOD2) and down-regulation of cytosolic copper zinc superoxide dismutase (CuZnSOD; SOD1) at their individual mRNA and protein levels. To evaluate the decreased CuZnSOD expression and the initiation of apoptosis we stably transfected macrophages to overexpress human CuZnSOD. Individual clones revealed a 2-fold increase in CuZnSOD activity. Expression of a functional and thus protective CuZnSOD was verified by attenuated superoxide (O2(.)-)-mediated apoptotic as well as necrotic cell death. In this study we showed that SOD-overexpressing macrophages (R-SOD1-12) were also protected against NO.-initiated programmed cell death. Protection was substantial towards NO. derived from exogenously added NO donors or when NO. was generated by inducible NO synthase activation, and was evident at the level of p53 accumulation, caspase activation and DNA fragmentation. Stimulation of parent and SOD-overexpressing cells with a combination of lipopolysaccharide and murine interferon gamma produced equivalent amounts of nitrite/nitrate, which ruled out attenuated inducible NO. synthase activity during protection. Because protection by a O2(.)--scavenging system during NO. -intoxication implies a role of NO. and O2(.)- in the progression of cell damage, we used uric acid to delineate the role of peroxynitrite during NO.-elicited apoptosis. The peroxynitrite scavenger uric acid left S-nitrosoglutathione or spermine-NO-elicited apoptosis unaltered, blocking only 3-morpholinosydnonimine-mediated cell death. As a result we exclude peroxynitrite from contributing, to any major extent, to NO. -mediated apoptosis. Therefore protection observed with CuZnSOD overexpression is unlikely to stem from interference with peroxynitrite formation and/or action. Unequivocally, the down-regulation of CuZnSOD is associated with NO. cytotoxicity, whereas CuZnSOD overexpression protects macrophages from apoptosis.  (+info)

(4/43244) Co-expression of glutathione S-transferase with methionine aminopeptidase: a system of producing enriched N-terminal processed proteins in Escherichia coli.

We describe here an Escherichia coli expression system that produces recombinant proteins enriched in the N-terminal processed form, by using glutathione S-transferase cGSTM1-1 and rGSTT1-1 as models, where c and r refer to chick and rat respectively. Approximately 90% of the cGSTM1-1 or rGSTT1-1 overexpressed in E. coli under the control of a phoA promoter retained the initiator methionine residue that was absent from the mature isoenzymes isolated from tissues. The amount of initiator methionine was decreased to 40% of the expressed cGSTM1-1 when the isoenzyme was co-expressed with an exogenous methionine aminopeptidase gene under the control of a separate phoA promoter. The recombinant proteins expressed were mainly methionine aminopeptidase. The yield of cGSTM1-1 was decreased to 10% of that expressed in the absence of the exogenous methionine aminopeptidase gene. By replacing the phoA with its natural promoter, the expression of methionine aminopeptidase decreased drastically. The yield of the co-expressed cGSTM1-1 was approx. 60% of that in the absence of the exogenous methionine aminopeptidase gene; approx. 65% of the initiator methionine residues were removed from the enzyme. Under similar conditions, N-terminal processing was observed in approx. 70% of the recombinant rGSTT1-1 expressed. By increasing the concentration of phosphate in the growth medium, the amount of initiator methionine on cGSTM1-1 was decreased to 14% of the overexpressed isoenzymes, whereas no further improvement could be observed for rGSTT1-1. The initiator methionine residue does not affect the enzymic activities of either cGSTM1-1 or rGSTT1-1. However, the epoxidase activity and the 4-nitrobenzyl chloride-conjugating activity of the purified recombinant rGSTT1-1 are markedly higher that those reported recently for the same isoenzyme isolated from rat livers.  (+info)

(5/43244) Differential regulation of the human nidogen gene promoter region by a novel cell-type-specific silencer element.

Transfection analyses of the human nidogen promoter region in nidogen-producing fibroblasts from adult skin revealed multiple positive and negative cis-acting elements controlling nidogen gene expression. Characterization of the positive regulatory domains by gel mobility-shift assays and co-transfection studies in Drosophila SL2 cells unequivocally demonstrated that Sp1-like transcription factors are essential for a high expression of the human nidogen gene. Analysis of the negative regulatory domains identified a novel silencer element between nt -1333 and -1322, which is bound by a distinct nuclear factor, by using extracts from adult but not from embryonal fibroblasts. In embryonal fibroblasts, which express significantly higher amounts of nidogen mRNA as compared with adult fibroblasts, this inhibitory nidogen promoter region did not affect nidogen and SV40 promoter activities. The silencer element seems to be active only in nidogen-producing cells. Therefore this regulatory element might function in vivo to limit nidogen gene expression in response to external stimuli. However, none of the identified regulatory elements, including the silencer, contribute significantly to cell-specific expression of the human nidogen gene. Instead we provide evidence that gene expression in epidermal keratinocytes that are not producing nidogen is repressed by methylation-specific and chromatin-dependent mechanisms.  (+info)

(6/43244) Role of retinoid receptors in the regulation of mucin gene expression by retinoic acid in human tracheobronchial epithelial cells.

To investigate which retinoid receptors are critical in the regulation by all-trans-retinoic acid (RA) of the mucin genes MUC2, MUC5AC and MUC5B in cultured normal human tracheobronchial epithelial (NHTBE) cells, we used pan-RAR-, pan-RXR- and RAR- isotype (alpha, beta and gamma)-selective agonists and RARalpha- and RARgamma-selective antagonists (RAR is RA receptor and RXR is retinoid X receptor). RAR-, RARalpha- and RARgamma-selective agonists strongly induced mucin mRNAs in a dose-dependent manner, while the RARbeta-selective retinoid only weakly induced mucin gene expression at very high concentrations (1 microM). The pan-RXR-selective agonist by itself did not induce mucin gene expression, but acted synergistically with suboptimal concentrations of the pan-RAR agonist. A retinoid with selective anti-activator-protein-1 activity only marginally induced mucin gene expression. The RARalpha antagonist strongly inhibited mucin gene induction and mucous cell differentiation caused by RA and by the RARalpha- and RARgamma-selective retinoids. In contrast, the RARgamma antagonist only weakly inhibited RARalpha-selective-retinoid-induced mucin gene expression, but completely blocked mucin gene expression induced by the RARgamma-selective retinoid. Our studies indicate that RARalpha is the major retinoid receptor subtype mediating RA-dependent mucin gene expression and mucous cell differentiation, but that the RARgamma isotype can also induce mucin genes. Furthermore these studies suggest that RARbeta is probably not (directly) involved in RA-induced mucin gene expression.  (+info)

(7/43244) Differential regulation of vascular endothelial growth factor and its receptor fms-like-tyrosine kinase is mediated by nitric oxide in rat renal mesangial cells.

Under conditions associated with local and systemic inflammation, mesangial cells and invading immune cells are likely to be responsible for the release of large amounts of nitric oxide (NO) in the glomerulus. To further define the mechanisms of NO action in the glomerulus, we attempted to identify genes which are regulated by NO in rat glomerular mesangial cells. We identified vascular endothelial growth factor (VEGF) and its receptor fms-like tyrosine kinase (FLT-1) to be under the regulatory control of exogenously applied NO in these cells. Using S-nitroso-glutathione (GSNO) as an NO-donating agent, VEGF expression was strongly induced, whereas expression of its FLT-1 receptor simultaneously decreased. Expressional regulation of VEGF and FLT-1 mRNA was transient and occurred rapidly within 1-3 h after GSNO treatment. Expression of a second VEGF-specific receptor, fetal liver kinase-1 (FLK-1/KDR), could not be detected. The inflammatory cytokine interleukin-1beta mediated a moderate increase in VEGF expression after 24 h and had no influence on FLT-1 expression. In contrast, platelet-derived growth factor-BB and basic fibroblast growth factor had no effect on VEGF expression, but strongly induced FLT-1 mRNA levels. Obviously, there is a differential regulation of VEGF and its receptor FLT-1 by NO, cytokines and growth factors in rat mesangial cells.  (+info)

(8/43244) Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.  (+info)

What kind of make up, primers and face washes are good for oily skin?

What kind of make up, primers and face washes are good for oily skin and that wont dry out or irritate skin.

I also have oily skin and these products have worked for me :)
-L'oreal go 360° Clean Deep Facial Cleanser for Sensitive Skin
-Merle Norman Daily Moisture Milky Cleanser
-Neutrogena Naturals Purifying Facial Cleanser
-Olay Pro-X Restorative Cream Cleanser
-Paula's Choice Earth Sourced Perfectly Natural Cleansing Gel
-Physicians Formula Hydrating & Balancing Cleanser

-Shiseido Smoothing Veil SPF 16
-Smashbox Photo Finish Targeted Pore & Line Primer
-Victoria's Secret VS Pro Airbrush FX Face Primer SPF 20
-Yves Saint Laurent Matt Touch
-Avon Primed For perfection Face Primer
-Estee Lauder Matte Perfecting Primer

What is a good eyeshadow base/primer for skin that is typically oily?

Does the skin type even matter when it comes to primers? I assume that my eyeshadow creases because of both long wear and oily eyelids.

Any base/primer suggestions are much appreciated, no matter the price range. Thanks!

The best option for you is the Urban Decay Primer Potion. Everyone is completely obsessed with it and it is the number one eyeshadow primer. It`s a must have to ensure that your eyeshadow will stay in place and to keep the color looking great all day! You can buy at Sephora or Ulta for around seventeen dollars. If you want a cheaper one then try Loreal Decrease base at drugstores or Wal-Mart. This works just as good and is around eight dollars. Hope I helped!

Is a primer important when applying eye makeup?

I have been looking and primers look kinda expensive. So I was wondering if they were an essential when using eye makeup? If so could you recommend some cheap primers?

Yes. It helps your eyeshadow stay on all day, and it can make your eyeshadow more vibrant.

Cheap, good primers you could buy are from elf. There is one in there dollar line, which is good, and an even better one in there 3 dollar line. They come in sheer and natural colored shades.

Dollar: http://www.eyeslipsface.com/products.asp?dept_id=2146

Three Dollars: http://www.eyeslipsface.com/minerals/eyes/concealers_and_primers/eyeshadow_primer

You could also just use bases if you want as a primer. Nyx cosmetics has some great eye shadow pencils that are very creamy & great for bases.

If you want more expensive primers to save up on, Urban Decay primer Potion And Too Faced Shadow Insurance are good 18-20 dollar ranged primers.

What are the different types of primers?

What are the different types of primers, their pros and cons? And do you have any suggestions on affordable ones, I don't have a lot of money to spend, I just want something effective that doesn't cause acne. This would be for applying mineral powder foundation.

All primers are expensive.  I prefer Urban Decay Complexion Brightening foundation primer.  I know L'oreal has an eye primer now, but I don't know if they have a face primer.  A less expensive alternative to primers would be using a good lotion for the powder to stick to, and then a spray fixative like MAC's FIX+ to seal it all in.  

Also, people have been using Monistat Chafing Powder Gel as a face primer for a while now, and apparently it is amazing!  I've linked a review to it below.  Apparently it goes for a bout $6-10.00 in the stores, as opposed to $30-$50, which is what you will pay for leading brands.  

Good luck!

What is a primer and what is the best one to use?

What exactly is a primer and what is the best one to use? Also, are their different kinds of primers, like for the face and eyes, etc?

A primer helps your makeup to last longer, apply smoother, and for the face, help minimize pores. One of the best face primers is Smashbox Photofinish, but I also like Benefit's That Gal and Make Up For Ever's primer. For your eyes, especially if you have oily lids, I would recommend Urban Decay's Primer Potion. Other people really like Too Faced Shadow Insurance, and for dry or normal lids, you can use a paint or Paint Pot from MAC, or even your concealer.

Is it possible to put DNA from another women into one womens egg to cause a pregnancy?

I know they can use DNA form sperm for In vitro fertilization (IVF) but can they use DNA from the egg of another female?
Jill that is Very helpful, do you have a LINK or anything more about this, because i would appreciate that.

It's technically possible (scientists fertilized mouse eggs using non-sperm DNA as much as 10 years ago), but there are complications that make it impractical.  The sperm doesn't contain only DNA, but it also contains enzymes and chemicals that cause the process of fertilization to take place (the enzymes tell the egg to "get rid of" one copy of it's DNA, then join the sperm and egg DNA, then kick off the process of cell division).  Without those enzymes and chemicals, you'd have a cell containing 2 different sets of DNA, but nothing would happen next.

That being said, scientists are making great progress in combining the DNA of 2 eggs and THEN fertilizing the resulting egg with a sperm -- this is useful if you have a lesbian couple who wants to have a child that is biologically related to both of them.

Does anyone know of a good primer/oil control to put under Bare Minerals foundation?

I've already tried the Bare Minerals primer which I find to be more of an acne treatment than a primer.

I also put a little bit of the mineral veil after my moisturizer and before my foundation. Then I put the mineral veil after my foundation to set it. If I didn't do my skin would be much more oily. 

I've tried a few primers that are supposed to matte the skin, but the Bare Minerals doesn't stick to them very well and I end up having the melting make up problem. 

I'm getting married in three weeks and I want flawless skin.

I have combination skin that is acne prone.  It tends to be very oily during the day, but if I overload on acne products it peels.
 I have to use blotting papers throughout the day. 

Please help! Thanks.
Sorry Eli Star, but I can't forgo my bare minerals. It's the only foundation that will cover up my acne scars and doesn't make me break out. Thanks for the help though.

try "primetime" primer by barevitamins, it is made by bare escentuals, also, and works well with bare minerals. it absorbs excess oil, and evens out the skin texture. congrats on the up-coming wedding !

is it possible for a DNA test to be wrong and the child look just like the alleged father?

Is it possible to have a swab DNA test done and it come back that the alleged father is not the father. However my child looks just like him, as if he spit out. Can someone please help put a stop to my madness.

I think that it is highly ulikely, but i did see a tv show of a women who had several kids and her dna did not match any other her kids. She was accused of not being the mother and threatened to have the kids taken away from her until she was pregnant again and they watched her give birth to the child and then tested the newborn baby and the dna did not match the mother but obviously she was the mother.. i'm sure possibly it could happen with a father too, but probably super super rare.