Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Cloning, Organism: The formation of one or more genetically identical organisms derived by vegetative reproduction from a single cell. The source nuclear material can be embryo-derived, fetus-derived, or taken from an adult somatic cell.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Genes, Bacterial: The functional hereditary units of BACTERIA.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Gene Library: A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Open Reading Frames: A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.DNA, Recombinant: Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.Tissue Distribution: Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.Genomic Library: A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).Genetic Vectors: DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Multigene Family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)Molecular Weight: The sum of the weight of all the atoms in a molecule.Bacterial Proteins: Proteins found in any species of bacterium.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Organ Specificity: Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.Sequence Analysis: A multistage process that includes the determination of a sequence (protein, carbohydrate, etc.), its fragmentation and analysis, and the interpretation of the resulting sequence information.Cosmids: Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Oligonucleotide Probes: Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Transformation, Bacterial: The heritable modification of the properties of a competent bacterium by naked DNA from another source. The uptake of naked DNA is a naturally occuring phenomenon in some bacteria. It is often used as a GENE TRANSFER TECHNIQUE.Transformation, Genetic: Change brought about to an organisms genetic composition by unidirectional transfer (TRANSFECTION; TRANSDUCTION, GENETIC; CONJUGATION, GENETIC, etc.) and incorporation of foreign DNA into prokaryotic or eukaryotic cells by recombination of part or all of that DNA into the cell's genome.Genes, Fungal: The functional hereditary units of FUNGI.Sequence Homology: The degree of similarity between sequences. Studies of AMINO ACID SEQUENCE HOMOLOGY and NUCLEIC ACID SEQUENCE HOMOLOGY provide useful information about the genetic relatedness of genes, gene products, and species.In Situ Hybridization: A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Plant Proteins: Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Streptomyces: A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Kinetics: The rate dynamics in chemical or physical systems.Genes, Plant: The functional hereditary units of PLANTS.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.Alternative Splicing: A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Gene Expression Regulation, Enzymologic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.Cattle: Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.DNA, Fungal: Deoxyribonucleic acid that makes up the genetic material of fungi.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.DNA Transposable Elements: Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Operon: In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).COS Cells: CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.Isoenzymes: Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Poly A: A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.Nuclear Transfer Techniques: Methods of implanting a CELL NUCLEUS from a donor cell into an enucleated acceptor cell.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Mutagenesis, Insertional: Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.DNA, Plant: Deoxyribonucleic acid that makes up the genetic material of plants.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Bacteriophage lambda: A temperate inducible phage and type species of the genus lambda-like viruses, in the family SIPHOVIRIDAE. Its natural host is E. coli K12. Its VIRION contains linear double-stranded DNA with single-stranded 12-base 5' sticky ends. The DNA circularizes on infection.Consensus Sequence: A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.Physical Chromosome Mapping: Mapping of the linear order of genes on a chromosome with units indicating their distances by using methods other than genetic recombination. These methods include nucleotide sequencing, overlapping deletions in polytene chromosomes, and electron micrography of heteroduplex DNA. (From King & Stansfield, A Dictionary of Genetics, 5th ed)Gene Expression Regulation, Developmental: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Bacillus: A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.Chromosomes, Bacterial: Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.Enzyme Stability: The extent to which an enzyme retains its structural conformation or its activity when subjected to storage, isolation, and purification or various other physical or chemical manipulations, including proteolytic enzymes and heat.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Xenopus laevis: The commonest and widest ranging species of the clawed "frog" (Xenopus) in Africa. This species is used extensively in research. There is now a significant population in California derived from escaped laboratory animals.Rabbits: The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Oocytes: Female germ cells derived from OOGONIA and termed OOCYTES when they enter MEIOSIS. The primary oocytes begin meiosis but are arrested at the diplotene state until OVULATION at PUBERTY to give rise to haploid secondary oocytes or ova (OVUM).Recombination, Genetic: Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.Chromosome Walking: A technique with which an unknown region of a chromosome can be explored. It is generally used to isolate a locus of interest for which no probe is available but that is known to be linked to a gene which has been identified and cloned. A fragment containing a known gene is selected and used as a probe to identify other overlapping fragments which contain the same gene. The nucleotide sequences of these fragments can then be characterized. This process continues for the length of the chromosome.Codon: A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).Chromosomes, Artificial, Bacterial: DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.Chickens: Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.Clone Cells: A group of genetically identical cells all descended from a single common ancestral cell by mitosis in eukaryotes or by binary fission in prokaryotes. Clone cells also include populations of recombinant DNA molecules all carrying the same inserted sequence. (From King & Stansfield, Dictionary of Genetics, 4th ed)Pseudomonas: A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.Gene Expression Regulation, Plant: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.Bacillus subtilis: A species of gram-positive bacteria that is a common soil and water saprophyte.Fungal Proteins: Proteins found in any species of fungus.Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Deoxyribonuclease EcoRI: One of the Type II site-specific deoxyribonucleases (EC It recognizes and cleaves the sequence G/AATTC at the slash. EcoRI is from E coliRY13. Several isoschizomers have been identified. EC 3.1.21.-.Protein Sorting Signals: Amino acid sequences found in transported proteins that selectively guide the distribution of the proteins to specific cellular compartments.Oxidoreductases: The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)Brain: The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.Xenopus: An aquatic genus of the family, Pipidae, occurring in Africa and distinguished by having black horny claws on three inner hind toes.Insect Proteins: Proteins found in any species of insect.Genes, Viral: The functional hereditary units of VIRUSES.CHO Cells: CELL LINE derived from the ovary of the Chinese hamster, Cricetulus griseus (CRICETULUS). The species is a favorite for cytogenetic studies because of its small chromosome number. The cell line has provided model systems for the study of genetic alterations in cultured mammalian cells.Arabidopsis: A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Deoxyribonuclease HindIII: One of the Type II site-specific deoxyribonucleases (EC It recognizes and cleaves the sequence A/AGCTT at the slash. HindIII is from Haemophilus influenzae R(d). Numerous isoschizomers have been identified. EC 3.1.21.-.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Chromosomes, Artificial, Yeast: Chromosomes in which fragments of exogenous DNA ranging in length up to several hundred kilobase pairs have been cloned into yeast through ligation to vector sequences. These artificial chromosomes are used extensively in molecular biology for the construction of comprehensive genomic libraries of higher organisms.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.Pichia: Yeast-like ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES isolated from exuded tree sap.Plants: Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.Swine: Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).Genetic Markers: A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.Testis: The male gonad containing two functional parts: the SEMINIFEROUS TUBULES for the production and transport of male germ cells (SPERMATOGENESIS) and the interstitial compartment containing LEYDIG CELLS that produce ANDROGENS.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Deoxyribonucleases, Type II Site-Specific: Enzyme systems containing a single subunit and requiring only magnesium for endonucleolytic activity. The corresponding modification methylases are separate enzymes. The systems recognize specific short DNA sequences and cleave either within, or at a short specific distance from, the recognition sequence to give specific double-stranded fragments with terminal 5'-phosphates. Enzymes from different microorganisms with the same specificity are called isoschizomers. EC Oxidoreductases: A subclass of enzymes which includes all dehydrogenases acting on primary and secondary alcohols as well as hemiacetals. They are further classified according to the acceptor which can be NAD+ or NADP+ (subclass 1.1.1), cytochrome (1.1.2), oxygen (1.1.3), quinone (1.1.5), or another acceptor (1.1.99).Kidney: Body organ that filters blood for the secretion of URINE and that regulates ion concentrations.Oryza sativa: Annual cereal grass of the family POACEAE and its edible starchy grain, rice, which is the staple food of roughly one-half of the world's population.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Expressed Sequence Tags: Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.Genes, Regulator: Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.Membrane Glycoproteins: Glycoproteins found on the membrane or surface of cells.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Macromolecular Substances: Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.Hybrid Cells: Any cell, other than a ZYGOTE, that contains elements (such as NUCLEI and CYTOPLASM) from two or more different cells, usually produced by artificial CELL FUSION.

*  blunt-cloning - Molecular Cloning
blunt-cloning - Molecular Cloning. . BioJob. BioBlog. ... Forum Archives : : Molecular Cloning blunt-cloning - all are vector ... : 1 2 3 4 Next I subcloned a CYP3A4 cDNA into pShuttle vector Clonetech using blunt-end cloning method. I ... blunt-cloning - Molecular Cloning. Top : Forum Archives : : Molecular Cloning blunt-cloning - all are vector self-ligation products. Jul/11/2003 Pages: 1 2 3 4 Next I subcloned a CYP3A4 cDNA into pShuttle vector Clonetech using blunt-end cloning method. I use DraI a blunt-end enzyme to digest pShuttle and phosphatase using CIP. The insert was cut and then fill in at 5'end using Klenow. It is almost empty on the control plate of vetor itself with ligase, and almost hundreds of clones on the vector and insert plate. But when I selected around 50 clones using restriction digestion or bacteria PCR reaction, not one xlone containing insert. Anyway, perhaps you could try SAP Shrimp Alkaline Phosphatase from Roche, which I think is better than CIP. Good luck. -ivpz- tr...
*  CUSABIO Life science |
Protein Antibody Molecular Biology Product Small Molecule Raw ... Antibody. Molecular Biology Product. Small Molecule. Raw ... Protein Services. Molecular Biology Service. Small molecule ...  CUSABIO Life science. CUSABIO is your good partner in biology research. All Kit Protein Antibody Molecular Biology Product Small Molecule Raw Material of IVD Kit. Cusabio Story. Picture Gallery. Company Structure. Sitemap. News. Cusabio News. Biological News. Product center. Kit. Protein. Antibody. Molecular Biology Product. Small Molecule. Raw Material of IVD Kit. Service. Antibody Service. Protein Services. Molecular Biology Service. Small molecule Service. ELISA Service. Immunology Experiment Technical Service. Technical resources. Technical Support. Contact information. Contact Us. Product Center More >>. Kit ELISA Kit Elisa Kit For Food Safety & Drug Residues. Protein Native Protein Recombinant Protein. Antibody Polyclonal Antibody Secondary Antibody Monoclonal Antibody Tag/Control Antibodies...
*  OriGene - MRE11A (NM 005591) cDNA Clone
NM_005591 cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human ... OriGene - MRE11A NM 005591 cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. MRE11A NM 005591 Human cDNA Clone. SC116673 MRE11A untagged -Human MRE11 meiotic recombination 11 homolog A S. cerevisiae MRE11A, transcript variant 1, NM 005591.3, 10ug $185 In Stock. Protein Pathways: Homologous recombination Non-homologous end-joining. Reference Data RefSeq: NM 005591.3, NP 005582. MRE11A Mouse Clones SKU Description Amount Price Shipping. MC206210 Mre11a untagged - Mouse meiotic recombination 11 homolog A S. MR210160 Mre11a Myc-DDK-tagged - Mouse meiotic recombination 11 homolog A S. cerevisiae Mre11a 10 ug $850 Next day. MG210160 Mre11a GFP...
*  OriGene - LOX (NM 001178102) cDNA Clone
NM_001178102 cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human ... OriGene - LOX NM 001178102 cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. Home TrueClone LOX Clone. LOX NM 001178102 Human cDNA Clone. SC328289 LOX untagged -Human lysyl oxidase LOX transcript variant 2, NM 001178102.1, 10ug $380 In Stock. Reference Data RefSeq: NM 001178102.1, NP 001171573. LOX Mouse Clones SKU Description Amount Price Shipping. MC227552 Lox untagged - Mouse lysyl oxidase Lox, transcript variant 2 10 ug $370 2 weeks. MC227553 Lox untagged - Mouse lysyl oxidase Lox, transcript variant 3 10 ug $370 2 weeks. MC208031 Lox untagged - Mouse lysyl oxidase Lox, 10ug 10 ug $380 Next day. MR229763 Lox myc-DDK-tagged - Mouse...
*  OriGene - Cdkn2aip (NM 172407) Human ORF cDNA Clone
Human ORF cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human ... OriGene - Cdkn2aip NM 172407 Human ORF cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. Related Products DDK Tagged Cdkn2aip ORF Clone. Home cDNA Clone TrueORF All Cdkn2aip ORF Clones. Cdkn2aip NM 172407 Mouse cDNA ORF Clone Western Blot Validated. MG221557 Cdkn2aip GFP-tagged - Mouse CDKN2A interacting protein Cdkn2aip, 10ug, 10µg $750. TrueORF Data for MG221557. Reference Data RefSeq: NM 172407.3, NP 765995. RefSeq Size: 3494 RefSeq ORF: 1692. More ORF Clones Citations >>. Cdkn2aip Human Clones SKU Description Amount Price Shipping. SC114060 CDKN2AIP untagged -Human CDKN2A interacting protein CDKN2AIP 10 ug $185 Next day. RC204658 CDK...
*  OriGene - NOX4 (BC040105) cDNA Clone
NOX4 BC040105 cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human ... OriGene - NOX4 BC040105 cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. NOX4 BC040105 Human cDNA Clone. SC126416 NOX4 untagged -Human NADPH oxidase 4, mRNA cDNA clone MGC:48663 IMAGE:5590269, complete cds, BC040105.1, 10ug $185 In Stock. Reference Data RefSeq: BC040105.1, AAH40105. NOX4 Mouse Clones SKU Description Amount Price Shipping. MC219182 Nox4 untagged - Mouse NADPH oxidase 4 Nox4, 10ug 10 ug $690 Next day. MC228242 Nox4 untagged - Mouse NADPH oxidase 4 Nox4, transcript variant 2 10 ug $490 3 weeks. MC228075 Nox4 untagged - Mouse NADPH oxidase 4 Nox4, transcript variant 3 10 ug $450 3 weeks. MR230453 Nox4 myc-DDK-tagged - M...
*  OriGene - Angpt4 (NM 001106526) cDNA Clone
NM_001106526 cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human ... OriGene - Angpt4 NM 001106526 cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. Home TrueClone Angpt4 Clone. Angpt4 NM 001106526 Rat cDNA Clone. RN208775 Angpt4 untagged ORF - Rat angiopoietin 4 Angpt4, 10 ug, NM 001106526.1, 10ug $611 4 weeks. OriGene Data Vector: pCMV6 Entry With the native stop codon at the end of the ORF, the C-terminal Myc-DDK tag in the vector won’t be expressed. Reference Data RefSeq: NM 001106526.1, NP 001099996. Click to view all citations of TrueClone. More TrueClone Citations >>. Angpt4 Human Clones SKU Description Amount Price Shipping. SC304373 ANGPT4 untagged -Human angiopoietin 4 ANGPT4 10 ug $680 Next ...
*  OriGene - Jph4 (NM 001003711) cDNA Clone
NM_001003711 cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human...
*  OriGene - Kdm2a (NM 001108515) Human ORF cDNA Clone
Human ORF cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human ... OriGene - Kdm2a NM 001108515 Human ORF cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. Related Products Purified Human Protein shRNA TrueMAB Antibody Over-Expression Lysate. Home cDNA Clone TrueORF All Kdm2a ORF Clones. More ORF Clones Citations >>. Kdm2a Human Clones SKU Description Amount Price Shipping. SC309965 KDM2A untagged -Human lysine K -specific demethylase 2A KDM2A, transcript variant 1 10 ug $2090 Next day. SC332373 KDM2A untagged - Homo sapiens lysine K -specific demethylase 2A KDM2A, transcript variant 3 10 ug $650 13 weeks. RC234775 KDM2A Myc-DDK tagged - Homo sapiens lysine K -specific demethylase 2A KDM2A, transcript v...
*  OriGene - DNAAF1 (NM 178452) cDNA Clone
NM_178452 cDNA Clone. My Account. Shopping Cart. Home. ... 中文 Search:. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human ... OriGene - DNAAF1 NM 178452 cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. Home TrueClone DNAAF1 Clone. DNAAF1 NM 178452 Human cDNA Clone. SC307182 DNAAF1 untagged -Human leucine rich repeat containing 50 LRRC50, NM 178452.3, 10ug $680 3 weeks. OriGene Data Vector: pCMV6 Entry With the native stop codon at the end of the ORF, the C-terminal Myc-DDK tag in the vector won’t be expressed. Reference Data RefSeq: NM 178452.3, NP 848547. DNAAF1 Mouse Clones SKU Description Amount Price Shipping. MC204904 Dnaaf1 untagged - Mouse leucine rich repeat containing 50 Lrrc50, 10ug 10 ug $185 Next day. MR209635 Dnaaf1 Myc-DDK-tagged - Mouse leucine ...
*  Cloning Methods | Thermo Fisher Scientific
Cloning Methods. Thermo Fisher Scientific. Home. Life Sciences. Cloning. Cloning Methods. Cloning Methods. Cloning. TOPO® PCR Cloning. Gene Synthesis and Services. Blunt-end Cloning. TA Cloning® Kits. Gateway® Cloning. Restriction Enzyme Digestion and Ligation. Competent Cells for Transformation. Invitrogen Custom DNA Oligos. cDNA Libraries cDNA Library Construction. Vector NTI® Software. Seamless Cloning Genetic Assembly. Site-Directed Mutagenesis. Premade Clones / Clone Collections. Reverse Transcription cDNA Synthesis. Cloning Reagents. Cloning Applications. Cloning Methods. Plant Cloning. Cloning Services. Do-it-yourself Gene Synthesis. GeneArt™ Type IIs Assembly Kits. Cloning Learning Center. When you are trying out a new cloning method or simply looking for a recommendation this section covers common cloning methods and techniques. Blunt End Cloning. Zero Blunt® TOPO® Cloning Kits eliminates background making cloning blunt-ended products efficient fast. Clone Collections. Eliminate RNA isolation, cDNA s...
*  PCR Cloning | NEB
PCR Cloning. NEB. My NEB. My NEB. Return to Cloning Synthetic Biology. Learn about Cloning Synthetic Biology Traditional Cloning. PCR Cloning. PCR cloning differs from traditional cloning in that the DNA fragment of interest, and even the vector, can be amplified by the Polymerase Chain Reaction PCR and ligated together, without the use of restriction enzymes. These "A-tailed" products are then ligated to a complementary T-tailed vector using T4 DNA ligase, followed by transformation. How Does the NEB® PCR Cloning Kit Work. Behind the Product: The NEB® PCR Cloning Kit For the inside scoop on how NEB products come to be, learn the story behind the new NEB® PCR Cloning Kit. Overview of PCR Cloning PCR Cloning is an easy and reliable cloning method. PCR Cloning. Featured Products : NEB PCR Cloning Kit Q5 High-Fidelity DNA Polymerase NEB 5-alpha Competent E.coli. Find Additional Products for use in PCR Cloning applications: DNA Preparation Restriction Enzyme Digestion PCR Reverse Transcription cDNA Synthesis DNA ...
*  Recombinational cloning using engineered recombination sites - Invitrogen Corporation
Abstract: Recombinational cloning is provided by the use of nucleic acids, vectors and methods, in vitro and in vivo, for moving or exchanging segments of DNA molecules using engineered recombination sites and recombination proteins to provide chimeric DNA molecules that have the desired characteristic s and/or DNA segment s. 6277608 Recombinational cloning using nucleic acids having recombination sites 2001-08-21 Hartley et al. Deng, M.-D., and Coleman, J.R., “Ethanol Synthesis by Genetic Engineering in Cyanobacteria,” Applied and Environmental Microbiology 65:523-528, American Society for Microbiology 1999. 2A depicts an in vitro method of recombining an Insert Donor plasmid here, pEZC705 with a Vector Donor plasmid here, pEZC726, and obtaining Product DNA and Byproduct daughter molecules. 3A depicts an in vitro method of recombining an Insert Donor plasmid here, pEZC602 with a Vector Donor plasmid here, pEZC629, and obtaining Product here, EZC6prod and Byproduct here, EZC6Bypr daughter molecules. The react...
*  Gene cloning
Biology. Medicine. RSS Navigation Links Biology News Medicine News Biology Products Medicine Products Biology Definition Medicine Definition Biology Technology Medicine Technology Biology Dictionary Medicine Dictionary. HOME >> BIOLOGY >> DICTIONARY. Cloning is frequently employed to amplify DNA fragments containing genes, but it can be used to amplify any DNA sequence such as promoters,... Full article >>> Cloning Genes Gene cloning, or molecular cloning, has several different meanings to a molecular biologist ... Full article >>> What is cloning. technology," "DNA cloning," "molecular cloning," and " gene cloning " all refer to ... General molecular genetics techniques. Full article >>> Is cloning an organism the same as cloning a gene. Full article >>> Recombinant DNA and Gene Cloning. Full article >>> Biology of Disease ... Full article >>> Molecular Biology : Gene Cloning and Hybridization ... Full article >>> Cloning, process of creating an exact copy of a single gene, cell, or organism. Full article >>...
*  Cloning genes that make too much proteins
... Minsoo Yoon yoon at Sun Jun 29 19:23:43 EST 2003. Previous message: eluting DNA from paper Next message: Cloning genes that make too much proteins Messages sorted by:. Dear experts: I have a problem of cloning a fragment that includes a very strong promoter. The fragment seems to produce too much products that become toxic to cells. It is getting more and more difficult to isolate desired clones as the constructs become bigger and more complicated with more components. Unfortunately I'm using a PUC-based plasmid but changing the plasmid to a lower copy one would be my last option. Could anyone in the know please advise me on this. TIA. Previous message: eluting DNA from paper Next message: Cloning genes that make too much proteins Messages sorted by:. More information about the Methods mailing list....
*  cloning into bacterial expression vector - Molecular Cloning
cloning into bacterial expression vector molecular cloning biojob bioblog pubalert biotool bioproduct bioforum protocol home forum index home live discussion top forum archives molecular cloning cloning into bacterial expression vector problem in e coli ttransformation jan hi all i am trying to subclone pcr product from a plasmid into the bacterial expression vector ligation product shows the expected molecular weight no problem with the competant cells and transformation protocols as the control reaction set up showed positive colonies no colonies appear on the transformation plate need suggestion thanx novagene hi it happens i see it all the time you just need to repeat it make sure that the vector and insert used for ligation is not too much i have a rule which i follow if my clong doesn t work once i start from scratch coz i don t know where have i made a mistake if i have tc t c go to the forum page printer friendly version about terms of service privacy feedback sponsorship protocol online all rights re...
*  wrong insert? right insert?? - Molecular Cloning - BioForum
wrong insert. right insert?. - Molecular Cloning - BioForum. Jump to content. Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. Sign In. Create Account. This topic. Forums. Members. Help Files. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. BioVideo. View New Content. Forums. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. Contact Us. BioForum. Protocols and Techniques Forums. Molecular Cloning. Javascript Disabled Detected You currently have javascript disabled. Please re-enable javascript to access full functionality. wrong insert. right insert?. mushroom911, Nov 04 2013 01:44 AM. 2 replies to this topic #1. mushroom911. mushroom911. member Active Members. 10 posts. 0 Neutral. Posted 04 November 2013 - 01:44 AM Hi. I run my samples on agarose gel after restriction digestion. Some of the samples have insert but it looked slightly smaller than desired PCR product!. However, my seniors told me th...
*  ARS | Publication request: Molecular cloning and functional characterization of avian interleukin-19
Publication request: Molecular cloning and functional characterization of avian interleukin-19 ARS : Research. Related Topics Programs and Projects. ARS National Programs. ARS Office of International Research Programs. Title: Molecular cloning and functional characterization of avian interleukin-19 Authors. Submitted to: Molecular Immunology Publication Type: Peer Reviewed Journal Publication Acceptance Date: August 28, 2009 Publication Date: December 1, 2009 Repository URL: Citation: Kim, S., Miska, K.B., Mcelroy, A., Jenkins, M.C., Fetterer, R.H., Cox, C., Stuard, L., Dalloul, R. Molecular cloning and functional characterization of avian interleukin-19. Interpretive Summary: Understanding the components of the immune system of the chicken is very important on many different levels. Thus understanding the chicken immune system is important in better understanding of the vertebrate immune system. Interleukins are major components of the immune system and are used...
*  Molecular Cloning - BioForum - Page 53
... Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. Sign In. This forum. Forums. Members. Help Files. BioBlog. BioWiki. Quotes. BioVideo. Forums. BioBlog. BioWiki. Quotes. Contact Us. BioForum. Protocols and Techniques Forums. Molecular Cloning. Javascript Disabled Detected You currently have javascript disabled. Several functions may not work. Please re-enable javascript to access full functionality. Submit your paper to J Biol Methods today. Molecular Cloning. Any techniques related to molecular cloning including restriction digestion, ligation, transformation, plasmid... Please log in to post a topic. Mark this forum as read. Show answered topics. Show unanswered topics. Show all topics. Show topic type All Topics Open Hot Polls Locked Moved. Sort by Last Post Last Poster Topic Title Topic Starter Topic Started Attachments Replies Views. Time frame From Today Last 5 days Last 7 days Last 10 days Last...
*  Cloning & Expression Problem in HEK-293Ts - Molecular Cloning - BioForum
Cloning & Expression Problem in HEK-293Ts - Molecular Cloning - BioForum. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. Sign In. This topic. Forums. Members. Help Files. Forums. Contact Us. BioForum. Protocols and Techniques Forums. Molecular Cloning. Cloning & Expression Problem in HEK-293Ts Started by. IXA, Sep 24 2012 07:00 AM Cloning. Expression. HEK-293. Please log in to reply. 6 replies to this topic #1. IXA. IXA. 3 posts. 0 Neutral. Posted 24 September 2012 - 07:00 AM Hi everyone,. I've been having numerous problems cloning and expressing a gene of interest in a pCMV-Tag3a mammalian expression vector for quite some time now. However, upon transient transfection into HEK-293Ts, I am unable to detect expression the construct through Western blotting. Back to top. bob1. bob1. Thelymitra pulchella Global Moderators. 6,113 posts. 463 Excellent. Posted 24 September 2012 - 12:40 PM Welcome. Try lysing in 2x Laemml...
*  Ligation-independent cloning
ligation independent cloning ligation independent cloning ligation independent cloning lic is a form of molecular cloning that is able to be performed without the use of restriction endonucleases or dna ligase this allows genes that have restriction sites to be cloned without worry of chopping up the insert protocol design pcr primers with lic extension perform pcr to amplify gene purify pcr product create overhangs incubate vector and pcr product to anneal transform notes further reading category cloning category molecular biology...
*  Biology-Online • View topic - MOLECULAR CLONING
Biology-Online View topic - MOLECULAR CLONING. Login Welcome to Please login to access all site features. Create account. Log me on automatically each visit. Join for Free. 121316 members Answers to all your Biology Questions. Home. Blog. Forum. Dictionary. Articles. Tutorials. Books. Directory. Share your work. Biology-Online. Skip to content. Advanced search. Board index. General Biology. Molecular Biology. Change font size. Advanced search. FAQ. Register. Login. MOLECULAR CLONING. Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field. Moderator: BioTeam Post a reply. 10 posts Page 1 of 1. Reply with quote. MOLECULAR CLONING by siddharthsameer. Sun Jul 15, 2012 10:24 am HELLO EVERYONE I am about to start my cloning and I would like to know a proper calculation for the ligation Insert to vector. I saw many calculation but could not understand that, I would like to know how do you calculate the volume needed for the insert and the v... end
*  Pet cloning
'Pet cloning' is the cloning of a pet animal. The first commercially cloned pet was a cat named Little Nicky, produced in 2004 by Genetic Savings & Clone for a north Texas woman for the fee of US$ 50,000. On May 21, 2008 BioArts International announced a limited commercial dog cloning service through a program it called Best Friends Again. This program came on the announcement of the successful cloning of a family dog Missy, which was widely publicized in the Missyplicity Project. In September 2009 BioArts announced the end of its dog cloning service. release/ba09 10 09.htm In July 2008, the Seoul National University created five clones of a dog named Booger for its Californian owner. Another feature of cloning differentiating a clone from the original is altered epigenetics : primarily alterations to DNA and histones that result in changes in gene expression, which importantly can result in changes in appearance and behavior. Since epigenetics is different in different tissues, a...
*  Luciferase assay problem - Molecular Cloning - BioForum
... Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. Sign In. Create Account. This topic. Forums. Members. BioBlog. BioWiki. Quotes. BioVideo. Forums. BioBlog. BioWiki. Quotes. Contact Us. BioForum. Protocols and Techniques Forums. Molecular Cloning. Javascript Disabled Detected You currently have javascript disabled. Luciferase assay problem Started by. chonela, Jul 04 2013 01:15 AM pGL3. 2 replies to this topic #1. chonela. chonela. 4 posts. Posted 04 July 2013 - 01:15 AM Hi!. I am using Dual Luciferase System and the pGL3Basic vector to perform luciferase assays. After transfection with the pGL3 and Renilla-luciferase vectors, cells are treated with retinoic acid or the vehicle DMSO. I have noticed that cells treated with retinoic acid exhibited an increase in luciferase activity but the problem is that cells transfected with pGL3Basic presents high luciferase activity also. 1,175 posts. Posted 07...
*  Restriction digestion of gDNA for phage library - Molecular Cloning
... BioJob BioBlog PubAlert BioTool BioProduct BioForum Protocol Home. Forum Index 1999-2009 Home Forum Index 2009- Home Live Discussion. Top : New Forum Archives 2009- : : Molecular Cloning. Restriction digestion of gDNA for phage library - Aug/16/2010 Visit this topic in live forum Printer Friendly Version Hi All, I have a query regarding construction of a phage library. I have purchased the Zap express vector kit predigested with EcoRI. while others partially digest with 4bp cutters such as Sau3A1 and fill in two of the nucleotides. Difference in average insert length depending on the genome of interest. -NemomeN007-. NemomeN007 on Mon Aug 16 17:56:43 2010 said:. Difference in average insert length depending on the genome of interest. Why do they need to fill in nucleotides on 4bp cutter and not on the 6bp?. -proteinz-. It depends on the protocol and what you need to accomplish. Without the protocol, I don't really know...usually it's to create a blunt end for linker ligations or variations thereo...
*  Very difficult cloning project - how to clone something that is not compatible w - Molecular Cloning
... - BioForum. Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. Sign In. This topic. Forums. Forums. BioForum. Molecular Cloning. Javascript Disabled Detected You currently have javascript disabled. peachkins, Jun 13 2013 07:40 PM. peachkins. peachkins. 2 posts. Posted 13 June 2013 - 07:40 PM I have a vector, into which I have cloned several genes - finally. All that is left to do is to remove the hsp70 promoter from the vector and replace it with the bactin2 promoter from another vector i have. The problem is that the restriction sites rs on either side of the hsp70 promoter are SacI, and SalI and xbaI is right next to SalI, while the rs on either side of bactin2 are ApaI and XhoI. These enzymes are not compatible with each other, and I cannot PCR the destination vector with ApaI and XhoI sites in the primers because there are numerous ApaI and XhoI sites at important places in the vector. I cannot PCR...
*  southern blot probe design - Molecular Cloning
... . BioJob. BioBlog. PubAlert. BioTool. BioProduct. BioForum. Protocol. Forum Index Home. Live Discussion. Top : Forum Archives : : Molecular Cloning southern blot probe design - Dec/21/2006 Hi I am new here May someone can help me I would like to do a southern blot to screen for alternative splicing variants of 5 genes in different cDNA libraries I am thinking to use radiactivity labeling. I have each gene cDNA cloned into vector that i can use as positive control and to generate probes. My question is about the probe design: I have different options and I'd like to know which one is the more sensitive : - extract the cDNA using restriction enzyme. The longest is about 1.8 kb. - extract only the conserved domain between all the variants that is around 300 pb long using restriction enzyme or PCR it - design a short specific oligo 40 pb Thanks in advance for your help Sophie -Sosous- Ordinarily, longer is better for Southern blot probes. However, given what you're trying to do, I think your PCR stra...
*  transgene expression - Molecular Cloning
... Top : Forum Archives : : Molecular Cloning transgene expression - Jan/27/2007 Hello all This is my first post and I would like to collect some general information about overexpression of a gene. Which binary vector would be the best choice. -sijo- Hi Sijo, My major advice is to read as much about each technique as you can. Searching the archives is also a brilliant resource - that's at the bottom of the search page - you can also search the current posts as well in the search area. With regard to answering your specific question, my area of expertise is cloning, so my major piece of advice would be to choose the restriction sites you wish to clone your fragment into wisely. Vector religation is a major issue with cloning and good choice of restriction sites greatly reduces vector re-ligation and thereby increases the proportion of vectors that contain insert. Here are my tips on choosing RE sites they are mostly aimed at reducing vector re-ligation : -choose different restriction sites on the 5`a...
*  Re: cloning device close race?
re cloning device close race tech kern archive date index thread index old index re cloning device close race to christos zoulas christos astron com localhost subject re cloning device close race from thor lancelot simon tls panix com localhost date sun dec on mon dec at am christos zoulas wrote in article ga panix com localhost thor lancelot simon tls panix com localhost wrote i wrote the attached test program as a benchmark for the new dev random implementation if you run or so copies at once on a multiprocessor system with diagnostic you ll see a lot of this message emitted vrelel missing vop close vnode xfffffe e cb flags x mpsafe lockswork inactnow tag vt ufs type vchr usecount writecount holdcount freelisthd x mount xffff data xfffffe de f lock xfffffe e cc tag vt ufs ino on dev flags x nlink mode owner group size i am guessing the problem also exists with other cloning pseudodevices not just the new dev random implementation does adding vn close nd ni vp flags l l cred just after fd dupopen in vfs sysc...
*  Help me! No colonies! Problem with gel purification? - Molecular Cloning
Help me! No colonies! Problem with gel purification. - Molecular Cloning. Protocol. Top : Forum Archives : : Molecular Cloning Help me! No colonies! Problem with gel purification. I'm trying to clone promoter fragments into GFP expression vector pEGFP-1. I'm PCRing my promoter fragment with added restriction enzyme sites from genomic DNA using Taq, subcloning it into TOPO vector with success, although not consistent!, isolating promoter fragment by restriction digest, running on gel, purifying with kit, ligating into pEGFP overnight and transforming and finding no colonies!!!!! I'm sure it's the gel purification that's the problem because when I ligate digested products that have been cleaned up phenol chloroform but not selected by gel purification, I get colonies, although I obviously have to screen a large number to get one with the correct insert in the correct vector. i don't know what is going wrong as thus technique was working perfectly f...
*  Cloning - OpenWetWare
... Cloning From OpenWetWare Difference between revisions Jump to: navigation, search Revision as of 21:02, 12 January 2012 view source Christopher C Vanlang Talk. Current revision 21:03, 12 January 2012 view source Christopher C Vanlang Talk. → Transformation. Transformation is the process of introducing foreign DNA e.g plasmids, BAC into a bacterium. Transformation is the process of introducing foreign DNA e.g plasmids, BAC into a bacterium. - ==== Reagents ====. + ' Reagents '. * ]: XL2-Blue Stratagene 200150. * ]: XL2-Blue Stratagene 200150. back to protocols. 1 General Procedure 2 Materials 2.1 Equipment 2.2 Media and plates. 3 Procedure 3.1 Enriching the insert 3.2 Restriction Digest 3.3 Ligation 3.4 Transformation 3.5 Screening. 8 Protocols 8.1 General 8.2 Lab-specific protocols. General Procedure. See the bottom of this article for specific protocols. Materials. Reagents. The insert can come from another vector or loaded from a PCR product. PCR product should be clean by various purification methods ...
*  Ligation of digested plasmid to hairpin oligo - Molecular Cloning - BioForum
... Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. This topic. Molecular Cloning. Ligation of digested plasmid to hairpin oligo Started by. anthony. anthony. 3 posts. 0 Neutral. Posted 10 September 2009 - 08:35 AM I have digested pBluescript II KS- with SapI and have a hairpin of ~15bp with a complementary SapI overhang starts with 5' - AGC... I was trying to ligate the two together, but have been getting a lot of concatamers I believe of pBS to itself. Veteran Active Members. 367 posts. 8 Neutral. Posted 10 September 2009 - 03:55 PM I have digested pBluescript II KS- with SapI and have a hairpin of ~15bp with a complementary SapI overhang starts with 5' - AGC... I was trying to ligate the two together, but have been getting a lot of concatamers I believe of pBS to itself. Get to know your heart... anthony. anthony. 3 posts. Posted 14 September 2009 - 05:37 AM I have digested pBluescript II KS- with SapI and have a ha...
*  How to get pure protein of a gene - Molecular Cloning - BioForum
... Jump to content. Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. . Sign In. Create Account. Search Advanced. Search section:. This topic. Forums. Members. Help Files. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. BioVideo. View New Content. Protocol Online. BioPortal. Forums. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. Contact Us. More. BioForum. Protocols and Techniques Forums. Molecular Cloning. . Javascript Disabled Detected You currently have javascript disabled. Several functions may not work. Please re-enable javascript to access full functionality. Submit your paper to J Biol Methods today. How to get pure protein of a gene Started by. saimasbs, Apr 26 2012 09:02 AM pure. protein. Please log in to reply. 3 replies to this topic #1. saimasbs. saimasbs. member Active Members. 5 posts. 0 Neutral. Posted 26 April 2012 - 09:02 AM i m working on protein expression. i hav only availa...
*  cdna library. - Molecular Cloning
cdna library molecular cloning biojob bioblog pubalert biotool bioproduct bioforum protocol home forum index home forum index home live discussion top new forum archives molecular cloning cdna library dec visit this topic in live forum printer friendly version hello everyone i constructed cdna library using clontech kit but i didn t get any result when i used my stored competent cells which i made days back stored in i e colonies neither in control nor in negative only competent cell freshly prepared cells gave me results it made electrocompetents and during first transformation i we gave electric pluse of voltsand during second transformation gv volt pluse now i m confused is there any problem with my competent cells or in giving pluse or is there anyother problem so please help me dips there are two types of competent cells which have different preparation procedures those that can be frozen and those that must be used fresh you should check which type you are using bob hi bob thanx for ur reply the protoco...
*  Ligation of large ammount of insert (no transformation) - Molecular Cloning - BioForum
Ligation of large ammount of insert no transformation - Molecular Cloning - BioForum. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. Sign In. This topic. Forums. Members. Forums. BioForum. Protocols and Techniques Forums. Molecular Cloning. Ligation of large ammount of insert no transformation Started by. Eddie*, Feb 18 2013 01:55 AM ligation. 7 replies to this topic #1. Eddie*. Eddie*. 3 posts. 0 Neutral. My Insert is about 500bp big, my vector 5590bp. I use a mol-ratio of insert:vector 3:1. To get the total DNA conentration of about 10 g/mL I want to use a total volume of 500 L and 3 L of T4 DNA Ligase NEB. How much T4 Ligase would you use. Back to top. neuron. neuron. Veteran Active Members. 210 posts. 5 Neutral. Otherwise your ratios of insert and vector look fine. How much T4 DNA ligase you will use. 50ul ...No experience of setting up this big ligation but at least 15ul should be used,....good luck. Back to top. phage434...
*  Plasmid linearization by PCR - Molecular Cloning - BioForum
... Jump to content. Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. . Sign In. Create Account. Search Advanced. Search section:. This topic. Forums. Members. Help Files. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. BioVideo. View New Content. Protocol Online. BioPortal. Forums. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. Contact Us. More. BioForum. Protocols and Techniques Forums. Molecular Cloning. . Javascript Disabled Detected You currently have javascript disabled. Several functions may not work. Please re-enable javascript to access full functionality. Submit your paper to J Biol Methods today. Plasmid linearization by PCR Started by. Teagan27, Aug 12 2009 02:50 AM. Please log in to reply. 4 replies to this topic #1. Teagan27. Teagan27. member Active Members. 15 posts. 0 Neutral. Posted 12 August 2009 - 02:50 AM Hi,. I am attempting to linearize a plasmid by PCR.. however.. i am g...
*  no colony - Molecular Cloning - BioForum
... Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. Sign In. This topic. Forums. Members. BioWiki. Quotes. Forums. BioWiki. Quotes. Contact Us. BioForum. Protocols and Techniques Forums. Molecular Cloning. no colony Started by. plasmamembrane, Jan 12 2014 11:02 AM ligation. transformation. no colony. 3 replies to this topic #1. plasmamembrane. plasmamembrane. member Active Members. 19 posts. Posted 12 January 2014 - 11:02 AM Hello,. I gel purified the DNA and set up restriction digestion with both enzymes BamH1-HF and HindIII-HF from NEB in Cutsmart buffer. After digestion, I gel purified again. The vector was prepared by digesting with both RE and purified by gel extraction. Transformation:. heat shock: 42degC for 45 sec. Need your help. Back to top. phage434. phage434. 2,698 posts. Posted 12 January 2014 - 02:14 PM Test your PCR product for correct digestion. 1 PCR as before. 2 Column cleanup of the PCR product no UV or gel....
*  Open protocol for Ligase Independent Cloning - Biology Stack Exchange
... chat blog. Biology. Biology Meta. your communities. Sign up or log in to customize your list. more stack exchange communities. Stack Exchange. sign up log in tour. help. Help Center Detailed answers to any questions you might have. Biology Questions. Ask Question. Sign up. Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. Open protocol for Ligase Independent Cloning. up vote 3 down vote favorite. Ligase Independent Cloning is a protocol that allow an insert to be integrated into a vector without ligation. It uses T4 DNA polymerase with only ATP to first chew back from blunt ends to create long sticky ends and then a polymerase treatment with full dNTP compliments to fill in the vector. Can anyone point to a full step by step recipe to make this work, once you have designed the primers. cloning protocol polymerase share. shigeta 21.7k. add a comment. You can look up Gibson Assembly or Circular Polymerase Extension cloning CPEC. answered Jun 19 '12 at 21...
*  OSNews > Thread > "Cloning the BeOS" by robertojdohnert
... OSNews Forgot Password. Register Login to OSNews. Search OSNews. BeOS-Like Distro Focused on Content Creation Linked by Tony Steidler-Dennison on Tue 15th Jul 2008 17:16 UTC A new Ubuntu-based Linux distribution has arrived, aimed at both Linux newbies and content creators. Thread beginning with comment 323198 To read all comments associated with this story, please click here. Cloning the BeOS by robertojdohnert on Wed 16th Jul 2008 16:09 UTC. I have the BeOS theme and look because basically I loved it as did one of my users when he recommended it and I made a theme for him." My words. If you want to go knock on someones door and tell them how clueless they are for trying to recreate the BeOS with a Linux kernel, go talk to ZevenOS and tell them how cluessless and stupid they are. RE: Cloning the BeOS by JacobMunoz on Wed 16th Jul 2008 17:29 in reply to " Cloning the BeOS ". Member since: 2006-03-17. "go talk to ZevenOS and tell them how cluessless and stupid they are" tragically, I don't speak German.. ...
*  User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14 - OpenWetWare
... User:Karmella Haynes/Notebook/BioBrick cloning/2013/03/14 From OpenWetWare User:Karmella Haynes. BioBrick cloning. 03 Difference between revisions Jump to: navigation, search Revision as of 21:37, 14 March 2013 view source Karmella Haynes Talk. Current revision 16:45, 9 April 2013 view source Karmella Haynes Talk. - 'New mammalian expression vector MV9 and MV10 ' br. + 'New mammalian expression vector MV9' br. * Use the to design oligo-assembly inserts for MV6 pcDNA3.1+ puro, mammalian transfection vector; CMV promoter. * Use the to design oligo-assembly inserts for MV6 pcDNA3.1+ puro, mammalian transfection vector; CMV promoter. - nbsp; nbsp; u A /u GGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTAGTGGTGGTAGTGCGCATTTCGACTC u TGATC /u /font br. + nbsp; nbsp; aGGGCGGCGGTGGTACCTCAGATCTGGGTTCTTTTTCGCGTTCCATGTGGTA u GTGGTGGTAGTGCGCATTTCGACTCtgatc /u /font br. # 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC. # 30-mer 5'-ctagtCCCGCCGCCACCATGGAGTCTAGAC. Karmella's BioBrick Cloning. New vector: design new vector fo...
*  if you plate 40 ul of your electrocomp cells only... - Molecular Cloning
... Top : Forum Archives : : Molecular Cloning if you plate 40 ul of your electrocomp cells only... - would you get any colonies. Jan/11/2007 Pages: Previous 1 2 QUOTE fred_33 Jan 16 2007, 03:23 AM Ok. I mean after electroporation of a plasmid that contain the AmpR gene, i let agitate the bacterias in LB for 30 to 45' in general. When the plasmid holds the KanR gene, i've compared the time necessary for the bacterias to be ok for plating. I think it's because ampicilin just block formation of outter membrane of bacterias, which does not kill them but they just stop growing which explains satellites bacterias which just take advantage of ampicilin degradation by AmpR bacterias. So bacterias seem to need more time before plating after an electroporation with kana. so the antibiotics should be fine, but maybe extra heat sensitive -Kathy- QUOTE Kathy Jan 11 2007, 06:16 PM I have tried different cells mine and those of my friend and it seems that if i plate them on the plate containing antibio...
*  double transformations - Molecular Cloning
... BioJob BioBlog PubAlert BioTool BioProduct BioForum Protocol Home. Forum Index 1999-2009 Home Forum Index 2009- Home Live Discussion. Top : New Forum Archives 2009- : : Molecular Cloning. double transformations - Jan/09/2011 Visit this topic in live forum Printer Friendly Version HI all. I have been facing a strange problem. I am getting 2 different plasmids having the same ori of replication but different antibiotic resistant genes Amp and Kan in the same host cell. The size of both the plasmids are different -12kb and 2.8kb. I get these 2 plasmids on gel after isolation under kanamycin selection. I am not able to eradicate the amp resistant contamination as it lowers the other plasmid yield after subsequent subculture also. Plz give me some suggestions for coming out of this problem. -deespike-. Take your isolated DNA or better, a gel isolated sample of the band you want and re-transform into your strain. This will be easier than trying to cure the plasmid. If you really need to cure it, then EtBr expo...
*  ligation problem - Molecular Cloning - BioForum
... Jump to content. Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. . Sign In. Create Account. Search Advanced. Search section:. This topic. Forums. Members. Help Files. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. BioVideo. View New Content. Protocol Online. BioPortal. Forums. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. Contact Us. More. BioForum. Protocols and Techniques Forums. Molecular Cloning. . Javascript Disabled Detected You currently have javascript disabled. Several functions may not work. Please re-enable javascript to access full functionality. Submit your paper to J Biol Methods today. ligation problem Started by. sagar, Mar 09 2009 10:32 AM. Please log in to reply. 11 replies to this topic #1. sagar. sagar. genes Active Members. 38 posts. 0 Neutral. Posted 09 March 2009 - 10:32 AM hi there. im in a big problem .i have been doing this ligation experiment for 1 month and s...
*  No product after restriction digestion - Molecular Cloning - BioForum
... Members. xyz, Jun 08 2009 12:37 PM. xyz. xyz. member Active Members. 22 posts. 0 Neutral. Back to top. 6,113 posts. Posted 08 June 2009 - 05:05 PM Purification didn't work. Back to top. Veteran Active Members. 212 posts. 0 Neutral. Posted 09 June 2009 - 12:24 AM did u run a gel to check if you have your products after purification and before the restriction digestion. Back to top. Enthusiast Active Members. 68 posts. 0 Neutral. Back to top. xyz. xyz. member Active Members. 22 posts. 0 Neutral. Just after purification digested the product did u run a gel to check if you have your products after purification and before the restriction digestion. Just after purification digested the product did u run a gel to check if you have your products after purification and before the restriction digestion. Star activity depend on units of enzyme to conc of DNA, glycerol concentration and some other factors as well.I am using only 1 microliter of enzyme and that gives only 20units/microgram of DNA, so I am assumin...
*  Is it posible to make ligation with DNA digested and stored at -20 - Molecular Cloning
is it posible to make ligation with dna digested and stored at molecular cloning biojob bioblog pubalert biotool bioproduct bioforum protocol home forum index home live discussion top forum archives molecular cloning is it posible to make ligation with dna digested and stored at jan i want to know if i can use genomic dna digested and plasmid dna digested and stored at âºc for a long time to make a new ligation mariana we have most of our plasmids in c and thaw them when we need to use it for any clonign steps we also have the digested frgametns and or plasmids in c and use it for ligations i would typically warm the dna fragments to c for min before using it for ligations scolix we also keep all our daily used sample in c we preserve the stock in i keep mini prep sample on my desk t reesei go to the forum page printer friendly version about terms of service privacy ...
*  ligation - Molecular Cloning
... ligation - Apr/20/2009 Visit this topic in live forum Printer Friendly Version hi all. i have a vector of size 2.8kb that is cut with ecori and hindiii and insert of size 1.4kb cut with the same enzymes fermentas .i m confirmed about complete digestion taking place but the problem is with the ligation i have performed ligation using molar ratios of insert:vector in 1:1,3:1,4:1,6:1..............ihave tried all concntrations of vector startin from 50ng -500ng. i have tried to dephosphorylate the vector using sap promega .i keep it for 15mins in 37C and then deactivate the enzyme in 65C for 15mins. my ligation conditions are 16C for 16 hrs,4C for 12 hrs. Are you certain that the insert ends have digested completely. Are you sure the ligase is working properly. If the insert and the DNA ladder don't shift upwards to larger bands, your ligase isn't working properly. If the size marker does shift but you only get monomer and dimer-sized insert bands, one of the enzymes hasn't cut. You need to have ...
*  why they use isopropanal for precipitate DNA in midiprep - Molecular Cloning - BioForum
... Jump to content. Google Sign in options. Remember me This is not recommended for shared computers Sign in anonymously Don't add me to the active users list Privacy Policy. . Sign In. Create Account. Search Advanced. Search section:. This topic. Forums. Members. Help Files. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. BioVideo. View New Content. Protocol Online. BioPortal. Forums. BioBlog. BioWiki. Interest Groups. Calendar. Quotes. Contact Us. More. BioForum. Protocols and Techniques Forums. Molecular Cloning. . Javascript Disabled Detected You currently have javascript disabled. Several functions may not work. Please re-enable javascript to access full functionality. Submit your paper to J Biol Methods today. why they use isopropanal for precipitate DNA in midiprep Started by. klanarong, Feb 22 2010 12:12 AM. Please log in to reply. 5 replies to this topic #1. klanarong. klanarong. member Members. 4 posts. 0 Neutral. Posted 22 February 2010 - 12:12 AM I just to know in midiprep why they use isop...
*  RE Enzyme Aliquot Dates - Molecular Cloning
re enzyme aliquot dates molecular cloning biojob bioblog pubalert biotool bioproduct bioforum protocol home forum index home live discussion top forum archives molecular cloning re enzyme aliquot dates just from curiousity mar how long do people keep their restriction enzymes around past the aliquot date neb enzymes i believe come with the month and year they were tubed is that even a verb on the label digging in the i found some from atalante we have some from that still work fine phage go to the forum page printer friendly version about terms of service privacy feedback sponsorship protocol online all rights reserved...
... d a bailey gen at nof abdn ac uk wed feb est previous message bleomycin next message ethidium bromide in samples messages sorted by i am looking for a good kit for pcr cloning can you give me some ideas based on your experence the best so far for me is the ta cloning kit from invitrogen with a microliter pcr i use to microliters directly in microliters of competent cells follow their transformation protocol plate the entire transformation on two plates and voila bunches of white colonies and a few blue ones er maybe i m missing something here don t you need a ligation in there somewhere between the pcr and the transformation if not i d be very interested to hear the protocol i recently had a go with the promega t vector system which worked pretty well roughly whites to blues although only about half of the whites contained an insert i sequenced a couple of the whites with no insert and found deletions in the polylinker which is presumably due to the a bit of residual exonuclease activity in the ligase ye...
*  fast cloning
... d k dk at no email thankstospam net sun aug est previous message fast cloning next message fast cloning messages sorted by aes aes at donnotreply com wrote hi the few years that i have been cloning i have always used standard procedures for transformation i e min on ice after addition of plasmid lig mix followed by heatshock ice again more lb and hour of recovery i have just heard of other people that simply mix competent cells with plasmid and incubate at rt for min before plating is this another standard procedure and is it much more inefficient this will only work with ampicillin selection with others you have to allow for a time to synthesize appropriate gene product relative efficiency of rt vs heat shock probably depends on the nature of competent cells our inoue cells give more colonies w o heat shock standard ca cells i am told work better with shock dk previous message fast cloning next message fast cloning messages sorted by more information about the methods mailing list...
*  PCR Cloning (III)- Ligation Abnova antibody protein cell biology | SciVee
PCR Cloning III - Ligation Abnova antibody protein cell biology. SciVee. × Login. Username:. Password:. Register. Forget your password. Click Here. Follow @SciVee. login upload. Home. Journals. Conferences. Education. Search. All Content. All Content. Journals. Conferences. Education. Communities. SciveeCasts. Videos. All Content Journals Conferences Education Communities. SciveeCasts Videos. Please enter at least 3 characters. PCR Cloning III - Ligation. submitted by: abnova. Abnova - DNA ligation joins two linear DNA fragments together with covalent phosphodiester bonds between 3 hydroxyl ends of one nucleotide with the 5 phosphate end of another. In PCR cloning, insert DNA and vector digested by the same restriction enzyme can be ligated by DNA ligase. For more videos, visit Abnova. Solutions. Products. Journals. Conferences. TeachYou. Education. Brochure. Navigation. Upload. Search. Help. Partners. Terms. Privacy. About. Contact. Media. SciVee 2015....
*  PSC101
psc psc psc is a dna plasmid that is used as a cloning vector in genetic cloning experiments psc was the first cloning vector used in by herbert boyer and stanley norman cohen they demonstrated that a gene from a frog could be transferred into bacterial cells and then expressed by the bacterial cells history in the early s herbert boyer and stanley norman cohen produced psc the first plasmid vector for cloning purposes soon after successfully cloning two psc plasmids together to create one large plasmid they published the results describing the experiment in the cloning of genes into plasmids occurred soon after in psc became the first patented commercial dna cloning vector when patents were awarded to boyer and cohen the sc stands for stanley cohen although the original psc only contained tetracycline resistance and a restriction site for ecori the commercially available psc gained restriction sites for several enzymes including hindiii in addition to the ecori site references category molecular genetics...
*  Blund End Cloning Fails- Reason ?????
blund end cloning fails reason blund end cloning fails reason vijaykr vijaykr at gmail com tue nov est previous message protein binding in low salt buffers next message cloning fails trouble shoot please messages sorted by i have repeated three times this cloning and every time i get numerous colonies none of which contains any insert actually i am trying to clone a ecori cut insert into a vector that is almost kb i check my clones by colony pcr from the overnight grown single colonies from the bacterial plates this time i set up a control while performing transformation i transformed vector ecori cut and purified i got three colonies vector ecori cut column purified and cip treated and column purified i got colonies vector ecori cut column purified and cip treated and column purified plus insert ecori and purified in the ratio of and i got more than colonies can anyone explain what went wrong none of the colo...
*  Cloning cDNA directly from PCR products
... Christophe Jacob jacob at Thu Mar 5 14:16:45 EST 1998. Previous message: HPLC Hitachi help me Next message: Cloning cDNA directly from PCR products Messages sorted by:. Hello, I'd like to clone several PCR fragments into plasmid vector. Their size is ranging from 200 to 700 pb. Is it possible to use them for ligation after a step of purification PCIH, CI and precipitation then digestion with the restriction enzyme, without electrophorezing them on agarose gel. Best regards, Christophe. Previous message: HPLC Hitachi help me Next message: Cloning cDNA directly from PCR products Messages sorted by:. More information about the Methods mailing list....
*  OriGene - Search All Products
... My Account. Shopping Cart. Home. 中文 Search:. Your search returned 23 results. Expanded Search. Genes match for NM 030815 Similar terms to NM 030815 PDRG1 C20orf126;dJ310O13.3;PDRG;. TrueMAB - Made against Authentic Protein Antigens. Cited in Publication s. 15,000 ORF clones at $98 each 40% discount on over 20,000 antibodies ALL 0. Antibody 2. Protein 3. cDNA clones 6. RNAi 8. ELISA Kits 0. qPCR 2. Others 1. CRISPR 1. TA504411 Anti-PDRG1 Antibody 9 Images. Description: PDRG1 mouse monoclonal antibody, clone OTI4F12 formerly 4F12. Applications: WB, FC, IHC. Reactivity: Human. Recommended for:. TA312653 Anti-PDRG1 Antibody 2 Images. Description: Rabbit polyclonal anti-PDRG1 antibody. Applications: WB. Reactivity: Human, Mouse, Rat. < . >>. total pages: 1. SKU. Category. Expression Host. Description. $ Price. Availability. TP303661 Protein HEK293 cells Recombinant protein of human p53 and DNA damage regulated 1 PDRG1 680 398 In Stock. LY410685 Lysate HEK293T Transient overexpression lysate of p53 and DNA-dam...
*  Immunoscreening
... is a method of biotechnology to detect a polypeptide produced from a cloned gene clones are screened for the presence of the gene product a protein this strategy requires that a the library is made in an expression vector b antiserum to the protein is available radioactivity or an enzyme is coupled generally with the secondary antibody the radioactivity enzyme linked secondary antibody can be purchased commercially can detect different antigens in commercial diagnostics labs labelled primary antibodies are also used see also elisa blots category biotechnology...
*  three fragment cloning
*  Panasonic 14mm F2.5 review data at various sites.: Micro Four Thirds Talk Forum: Digital Photography
... Review. Reviews. Sample Images. Videos. Lenses. Forums. Forum index. Micro Four Thirds Talk Change forum Panasonic 14mm F2.5 review data at various sites. Shop cameras lenses ▾. Forum Parent First Previous Next Next unread. jericho77. Panasonic 14mm F2.5 review data at various sites. Aug 5, 2013. Reply to thread Reply with quote. Forum Parent First Previous Next Next unread. Posted by When Panasonic 14mm F2.5 review data at various sites. jericho77. Aug 5, 2013. Re: Panasonic 14mm F2.5 review data at various sites. Aug 5, 2013 3. Re: Panasonic 14mm F2.5 review data at various sites. Aug 5, 2013. Re: Panasonic 14mm F2.5 review data at various sites. Aug 5, 2013. Re: Panasonic 14mm F2.5 review data at various sites. jericho77. Aug 5, 2013. Aug 5, 2013. jericho77. Aug 5, 2013. Re: Panasonic 14mm F2.5 review data at various sites. jericho77. Aug 5, 2013. Re: Panasonic 14mm F2.5 review data at various sites. Aug 5, 2013 1. Re: Panasonic 14mm F2.5 review data at various sites. Alumna Gorp. Aug 5, 2013. ...
*  The genetic basis of a plant-insect coevolutionary key innovation. Proc Natl Acad Sci USA (PDF Downl
Proc Natl Acad Sci USA PDF Download Available. Proc Natl Acad Sci USA. © 2007 by The National Academy of Sciences of the USA fossil calibrated, Bayesian relaxed molecular clock estimation of the Pierinae–Coliadinae divergence. Fossil and molecular data agree that the Brassicales appeared by 90 to 85 Mya, which is much earlier than the parallel evolution of glucosinolates in the Euphorbiaceae 58 Mya 28. In this article, we directly address the timing of the appearance of the glucosinolate-feeding Pierinae, using several independent molecular datasets and various calibration methods to generate a robust estimate of when Pieridae evolved relative to their Brassicales host plants. Pieridae-specific temporal reconstruction used a Bayesian relaxed molecular clock method on EF-1. Current and expected diversity, and divergence estimates for the Coliadinae and Pierinae subfamilies of Pieridae. However, there are significantly more species of Pierinae than expected, eve...
*  Mystery of bacterial growth and resistance solved: Findings shed light on how bacteria form protecti
... ve biofilms -- ScienceDaily. Your source for the latest research news. Mystery of bacterial growth and resistance solved: Findings shed light on how bacteria form protective biofilms. Date: April 26, 2012 Source: The Scripps Research Institute Summary: Scientists have unraveled a complex chemical pathway that enables bacteria to form clusters called biofilms. Scientists at The Scripps Research Institute have unraveled a complex chemical pathway that enables bacteria to form clusters called biofilms. Past research had also revealed that nitric oxide is involved in influencing bacterial biofilm formation. Nitric Oxide Modulates Bacterial Biofilm Formation through a Multicomponent Cyclic-di-GMP Signaling Network. The Scripps Research Institute. "Mystery of bacterial growth and resistance solved: Findings shed light on how bacteria form protective biofilms." ScienceDaily. The Scripps Research Institute. Mystery of bacterial growth and resistance solved: Findings shed light on how bacteria form protective biof...
*  Mankin Lab - Publications
Browse by year: 2014    2013    2012    2011    2010    2009    2008    2007    2006    2005    2004    2003    2002    2001    2000    1999    1998    1997    1996    1995   . Proc Natl Acad Sci USA 111, 9804-9809. 2014 The general mode of translation inhibition by macrolide antibiotics Proc Natl Acad Sci USA 111, 15958–15963. Top. Top. Top. Proc Natl Acad Sci USA 108, 5931-5932. Proc Natl Acad Sci USA 108, 10496-10501. Vázquez-Laslop, N., Ramu, H., Mankin, A. 2011 Nascent peptide in the ribosome exit tunnel affects functional properties of the A-Site of the peptidyl transferase center Mol Cell 41, 321-330. Top. Proc Natl Acad Sci USA 107, 1983-1988. A., Xiong, L., Mankin, A. H D 2010 Structures of the Escherichia coli ribosome with antibiotics bound near the peptidyl transferase center explain spectra of drug action Proc Natl Acad Sci USA 107, 17152-...
*  GO:1900911 regulation of olefin biosynthetic process
... Services. Research. Training. Industry. About us. QuickGO A fast browser for Gene Ontology terms and annotations. EBI Databases QuickGO GO:1900911 regulation of olefin biosynthetic process. Search for terms by keyword or ID: apoptosis GO:0006915 Search for proteins by name or accession: tropomyosin P06727. Web Services. Dataset. Term Basket. Term Information ID GO:1900911. Name regulation of olefin biosynthetic process. Ontology Biological Process. Definition Any process that modulates the frequency, rate or extent of olefin biosynthetic process. GONUTS GO:1900911 Wiki Page. Synonyms. Synonyms are alternative words or phrases closely related in meaning to the term name, with indication of the relationship between the name and synonym given by the synonym scope. Click on the icon for more details. Type Synonym. exact regulation of olefin synthesis. exact regulation of olefin biosynthesis. exact regulation of olefin formation. exact regulation of olefin anabolism. Ancestor Chart This chart is interactive; ...
*  Albums by Smokey Robinson : Rhapsody
... JavaScript is disabled in your browser settings. requires JavaScript. Cancel. Free trial. x Music. Apps Devices. Pricing. Sign up. Company Info. Careers. Press Media. Partners. Account. Customer Support. Redeem Coupon. Buy a Gift. 2015 Rhapsody International Inc. ×. Rhapsody App for. Rhapsody International, Inc. Get app. Have the app. Music Apps Devices Pricing Listen Now Try Rhapsody. Sign In. Home. / Music. / Soul/R B. / Motown. / Smokey Robinson. / Facebook. Twitter. Albums by Smokey Robinson. Main Releases. Play. Smokey & Friends. Smokey Robinson. Play. Be Near Me. Smokey Robinson. Play. The Motown Years Live. Smokey Robinson. Play. Ev'ry Man Should Know. Smokey Robinson. Play. The Solo Anthology. Smokey Robinson. Play. The Stripped Mixes. Smokey Robinson. Play. Time Flies When You're Having Fun. Smokey Robinson. Play. Love Songs. Smokey Robinson. Play. Timeless Love. Smokey Robinson. Play. The Definitive Collection. Smokey Robinson. Play. 20th Century Masters: The Millennium Collection....
*  Robinson News | News | News Releases | Robinson Memorial Hospital
-Any- Foundation News Robinson News. Foundation Awards Scholarships Benefitting Employees September 25, 2014 The Robinson Memorial Hospital Foundation is pleased to announce the awarding of 9 scholarships to employees of Robinson Memorial Hospital and Rob... Robinson wins NorthCoast 99 Award 12 years in a row September 4, 2014 Robinson Memorial Hospital again has been named as one of the best 99 places to work in Northeast Ohio by the Employers Resource Council. Osteoporosis event to celebrate healthy aging month September 4, 2014 During Robinson Memorial Hospital’s celebration of healthy aging month, there will be a program on Osteoporosis on Wednesday, September 10 from 6 ... Foundation Awards Student Scholarships July 10, 2014 The Robinson Memorial Hospital Foundation is pleased to announce the award of seven scholarships to children of Robinson Memorial Hospital and Robi... Robinson Wound Care Center Joins Healogics, Inc. to Raise Awareness of Chronic Wounds May 29, 2014 The Robinson Wound Care Center at ...
*  Robinson News | News | News Releases | Robinson Memorial Hospital
-Any- Foundation News Robinson News. Foundation Awards Scholarships Benefitting Employees September 25, 2014 The Robinson Memorial Hospital Foundation is pleased to announce the awarding of 9 scholarships to employees of Robinson Memorial Hospital and Rob... Robinson wins NorthCoast 99 Award 12 years in a row September 4, 2014 Robinson Memorial Hospital again has been named as one of the best 99 places to work in Northeast Ohio by the Employers Resource Council. Osteoporosis event to celebrate healthy aging month September 4, 2014 During Robinson Memorial Hospital’s celebration of healthy aging month, there will be a program on Osteoporosis on Wednesday, September 10 from 6 ... Foundation Awards Student Scholarships July 10, 2014 The Robinson Memorial Hospital Foundation is pleased to announce the award of seven scholarships to children of Robinson Memorial Hospital and Robi... Robinson Wound Care Center Joins Healogics, Inc. to Raise Awareness of Chronic Wounds May 29, 2014 The Robinson Wound Care Center at ...
*  Robinson News | News | News Releases | Robinson Memorial Hospital
-Any- Foundation News Robinson News. Foundation Awards Scholarships Benefitting Employees September 25, 2014 The Robinson Memorial Hospital Foundation is pleased to announce the awarding of 9 scholarships to employees of Robinson Memorial Hospital and Rob... Robinson wins NorthCoast 99 Award 12 years in a row September 4, 2014 Robinson Memorial Hospital again has been named as one of the best 99 places to work in Northeast Ohio by the Employers Resource Council. Osteoporosis event to celebrate healthy aging month September 4, 2014 During Robinson Memorial Hospital’s celebration of healthy aging month, there will be a program on Osteoporosis on Wednesday, September 10 from 6 ... Foundation Awards Student Scholarships July 10, 2014 The Robinson Memorial Hospital Foundation is pleased to announce the award of seven scholarships to children of Robinson Memorial Hospital and Robi... Robinson Wound Care Center Joins Healogics, Inc. to Raise Awareness of Chronic Wounds May 29, 2014 The Robinson Wound Care Center at ...
*  Robinson Health Center at Aurora | Robinson Memorial Hospital
robinson health center at aurora robinson memorial hospital about us foundation volunteer speaker s bureau press room contact us patients visitors medical services nursing find a doctor locations careers patient portal home locations robinson health center at aurora robinson health center at aurora walden place aurora ohio the robinson health center at aurora offers expert physicians personalized care and the latest in medical technology in one convenient location services and physician practices aurora primary care diagnostic x ray and laboratory services northeast ohio ob gyn robinson rehab center and sport clinic directions view larger map your name your email recipient email your comments word verification visitors patient portal key phone numbers visiting hours wheelchair assistance wi fi at robinson memorial hospital locations robinson memorial hospital robinson medical arts building robinson professional center robinson health center at aurora robinson health center at brimfield robinson health center ...
*  Home | Robinson Memorial Hospital
Robinson Memorial Hospital. ABOUT US FOUNDATION VOLUNTEER SPEAKER'S BUREAU PRESS ROOM CONTACT US. Patients Visitors. Medical Services. Nursing. Find a Doctor. Locations. Careers. Patient Portal. Classes Events. Holiday Journeys - Grief Support. Mon, Oct 5, 2015. 2:00 PM - 4:00 PM. Holiday Journeys - Grief Support. Mon, Oct 5, 2015. 6:30 PM - 8:30 PM. Ostomy Support Group. Mon, Oct 5, 2015. 7:00 PM - 9:00 PM. Diabetes Support Group. Tue, Oct 6, 2015. 5:00 PM - 6:00 PM. Tue, Oct 6, 2015. 5:00 PM - 6:30 PM. Robinson In The News Robinson Memorial Hospital is now UH Portage Medical Center. Robinson Health System becomes part of University Hospitals on June 1. Robinson Memorial hosts 21st Annual Nursing Research Day. Robinson Memorial Hospital Foundation Hosts 2015 Robinson Society and Heritage Society Distinguished Giving Recognition. Doctors Receiving Top Scores in Patient Satisfaction Congratulations to the following doctors who rank in the 90th percentile on the Press Ganey Patient Satisfaction Survey. Jessica ...
*  Rehabilitation | Robinson Memorial Hospital
Rehabilitation. Robinson Memorial Hospital. ABOUT US FOUNDATION VOLUNTEER SPEAKER'S BUREAU PRESS ROOM CONTACT US. Patients Visitors. Medical Services. Locations. Patient Portal. Medical Services. Rehabilitation. Rehabilitation. The Robinson Rehab Center and Sport Clinic works to rehabilitate each patient to his or her maximum potential and works to provide the patient with the necessary skills to maintain his or her progress. Ongoing communication between the patient, therapist and referring physician is the foundation of the center's rehabilitation programs. View Aquatic Classes. Team of Professionals Each therapist strives to stay on top of the latest technology and treatments and passes this knowledge along to patients. All Robinson Rehab Center and Sport Clinic professionals are licensed or certified by the State of Ohio. The center provides:. Aquatic aerobics, aquatic exercise and water arthritis classes in Ravenna. Locations: Robinson Medical Arts Building. 6847 North Chestnut Street Ravenna, Ohio 44266...
*  Shamim Patel - UK address and phone number -
... People. All People Businesses Places Electoral Roll Directors. Make sure the biggest decision you'll make is also the best. People. AZ-People. Surname - Patel. Your results for Shamim Patel. Filter Search. Search by name and/or location using the search form at the top of the page. Get access to likely ages Find old friends and family Double check names of spouses and children Trace your family tree Find out who your neighbours are Verify people are who they say they are. Make sure the biggest decision you'll make is also the best. Find out more. previous. 110 Results for Shamim Patel. Looking for Shamim Patel. Below are the results from the UK Electoral Roll and Company Director data. You can narrow your search by adding a location above if you wish. Name Address Other Occupants Electoral Roll Director Info Length of Occupancy Neighbours Property Price. 1 Shamim Patel. Age Guide: 40-44. Reading, Berkshire, RG2 Full Address. View. 2 Shamim R Patel. Age Guide: 30-34. Leicester, Leicestershire, LE5 Full Ad...
*  Phillip Phillips News, Pictures, and Videos |
Home Celebs Phillip Phillips Phillip Phillips. Idol Managers Claim John Mayer's ex-manager plotted to jack "American Idol" champ Phillip Phillips out from under his contract with the show -- according to a new lawsuit, but the bigger news is Phil is a READ MORE > - 9/21/2015 2:51 PM PDT. Phillip Phillips I Want to be Gone, Gone, Gone From My Idol Contract Phillip Phillips says "American Idol" producers are ruining his career ... American Idol Winner Phillip Phillips Mother Popped for DUI Phillip Phillips' mother Sheryl Phillips -- who appeared on several episodes of "American Idol" during Phillip's championship run last season -- was arrested for DUI earlier today, TMZ has READ MORE > - 964 days ago. Phillip Phillips I LOVE MY FAMILY But ... READ MORE > - 1064 days ago. Phillip Phillips Family Idol Champ s Forcing Us To Sell Pawn Shop Phillip Phillips' family says the singer left them high and dry after winning "American Idol" -- refusing to help them out financially -- and now, they've been forced to sell th...
*  Shadowing | Robinson Memorial Hospital
Shadowing. Robinson Memorial Hospital. ABOUT US FOUNDATION VOLUNTEER SPEAKER'S BUREAU PRESS ROOM CONTACT US. Patients Visitors. Medical Services. Nursing. Find a Doctor. Locations. Careers. Patient Portal. Home. Volunteer. Shadowing. Shadowing. Robinson Memorial Hospital offers several types of opportunities for short-term observational learning experiences for high school, college and adult students pursuing healthcare careers. The process to apply for a shadow experience depends on the age of the applicant. Note: Robinson Memorial Hospital has a mandatory flu vaccination policy for all employees, volunteers, contracted workers and shadow students. Students wanting to shadow at Robinson Memorial must provide proof of receiving a flu vaccine during current flu season - either by a receipt showing the student's name and detail of service from the provider, an insurance benefits explanation or detailed note from a physician. Students can bring their vaccine documentation the morning of their assigned shadow exp...
*  [Haskell-cafe] System.Random.Shuffle fix
System.Random.Shuffle fix. System.Random.Shuffle fix friggin friggin frigginfriggins at Previous message: A small display problem using Helium Next message: System.Random.Shuffle fix Messages sorted by:. I was looking for a shuffling algorithm to shuffle mp3-playlists so was very happy to see System.Random.Shuffle: However I get errors,non-exhaustive patterns in function shufleTree or extractTree depending how I call it. Errors are at the bottom. I fixed it but I don't have the math skills to see if I perhaps broke it statistically ... Here is my fix, someone don't remember who, helped me a little : the shuffle at the end is with the fix. *Freet S.shuffle Loading package syb ... linking ... Loading package base- ... linking ... Loading package old-locale- ... linking ... Loading package old-time- ... linking ... Loading package random- ...
*  OriGene - LRRC2 (NM 024512) cDNA Clone
OriGene - LRRC2 NM 024512 cDNA Clone. cDNA Clones TrueORF cDNA Clones H/M/R Viral ORF Clones Destination Vector TrueClone Human TrueClone Mouse Organelle Marker Plasmids MicroRNA Tools Mutant and Variant Clones Plasmid Purification Kits Transfection Reagents Gene Synthesis Service. Home TrueClone LRRC2 Clone. LRRC2 NM 024512 Human cDNA Clone. SC310473 LRRC2 untagged -Human leucine rich repeat containing 2 LRRC2, NM 024512.2, 10ug $680 3 weeks. Reference Data RefSeq: NM 024512.2, NP 078788. Synonyms : leucine-rich repeat-containing 2; leucine rich repeat containing 2. More TrueClone Citations >>. LRRC2 Mouse Clones SKU Description Amount Price Shipping. MC211501 Lrrc2 untagged - Mouse leucine rich repeat containing 2 Lrrc2, 10ug 10 ug $380 3 weeks. MR216368 Lrrc2 Myc-DDK-tagged - Mouse leucine rich repeat containing 2 Lrrc2 10 ug $380 Next day. MG216368 Lrrc2 GFP-tagged - Mouse leucine rich repeat containing 2 Lrrc2, 10ug 10 ug $420 3 weeks. MR216368L1 Lenti ORF clone of Lrrc2 Myc-DDK-tagged - Mouse leucine ri...
just like a woman lyrics bob dylan sing lyrics bob dylan biography bob dylan albums bob dylan lyrics bob dylan just like a woman lyrics last updated pm sponsored links nobody feels any pain tonight as i stand inside the rain ev rybody knows that baby s got new clothes but lately i see her ribbons and her bows have fallen from her curls she takes just like a woman yes she does she makes love just like a woman yes she does and she aches just like a woman but she breaks just like a little girl queen mary she s my friend yes i believe i ll go see her again nobody has to guess that baby can t be blessed till she finally sees that she s like all the rest with her fog her amphetamine and her pearls she takes just like a woman yes she does she makes love just like a woman yes she does and she aches just like a woman but she breaks just like a little girl it s was raining from the first and i was dying there of thirst so i came in here and your long time curse hurts but what s worse is this pain in here i can t stay i...
*  Gary Phillips eBooks | epub and pdf downloads | eBookMall
Gary Phillips eBooks. epub and pdf downloads. eBookMall. Search. Sponsored link: What is YOUR Secret Talent. - Take a Free Personality test. Gary Phillips eBooks Epub and PDF format. Gary Phillips eBooks. eBooks found: 15 Occupied Earth: Stories of Aliens, Resistance and Survival at all Costs. Richard Brewer. Gary Phillips Polis Books, October 2015. ISBN: 9781940610528 Format: ePub. List Price: $ 9.99 Our price: $ 7.99. Violent Spring. Gary Phillips, June 2014. ISBN: 9781784087968 Format: ePub. List Price: $ 13.11 Our price: $ 9.99. Perdition, U.S.A. Gary Phillips, June 2014. ISBN: 9781784087975 Format: ePub. List Price: $ 13.11 Our price: $ 9.99. Bad Night Is Falling. Gary Phillips, June 2014. ISBN: 9781784087982 Format: ePub. List Price: $ 13.11 Our price: $ 9.99. Only the Wicked. Gary Phillips, June 2014. ISBN: 9781784087951 Format: ePub. List Price: $ 13.11 Our price: $ 9.99. The Extractors. Gary Phillips Stark Raving Group, M...
*  "Beyond Stroke" Support Group | Events | Calendar of Events | Robinson Memorial Hospital
beyond stroke support group events calendar of events robinson memorial hospital about us foundation volunteer speaker s bureau press room contact us patients visitors medical services nursing find a doctor locations careers patient portal beyond stroke support group calendar view back to previous page support groups tuesday october pm pm description stroke survivors and caregivers will benefit from information presented by a variety of speakers as well as from sharing and support of their peers for information call jan bahle at location robinson medical arts building rmab n chestnut st ravenna ohio contact healtheducation rmh org phone visitors patient portal key phone numbers visiting hours wheelchair assistance wi fi at robinson memorial hospital locations robinson memorial hospital robinson medical arts building robinson professional center robinson health center at aurora robinson hea...
*  Deposition of Bobby Phillips States That Erwin Cain Sold Cocaine
... Home About Stories. Featured. BOR Featured. User Stories. Deposition of Bobby Phillips States That Erwin Cain Sold Cocaine. Deposition of Bobby Phillips States That Erwin Cain Sold Cocaine 3. By Burnt Orange Report. on October 19, 2010. Bobby Phillips, Jr. Phillips states that he met Erwin Cain in October of 1977, when he was engaged to Erwin's sister, Gloria Cain. Attorney : Did you ever see Mr. Erwin Cain sell drugs. Phillips : Yeah, I've seen him deliver to his brother-in-law, to his brother, and to other people that came by the house when he was there. Attorney : Do you know where Thomas Cain, Jr. Attorney: which brother would that be. Phillips : Erwin. Attorney: Just to clarify, and let me repeat it's your statement that you have seen, in the past, a man you can identify as Erwin Cain use marijuana. Phillips : Yes. Attorney: Have you, and is it your statement also that you have seen him sell marijuana to someone. Phillips : Yeah. Phillips : It was usually just we used to go over to his h...
*  Anthony Robinson |
Anthony Robinson. English. Fran ais. Espa ol. Deutsch. Italiano. Portugu s Login. Register. Themes New fonts Authors Top Forum FAQ Submit a font Tools. 4 matching requests on the forum Anthony Robinson 1. 2 3. Anthony Robinson. View profile Send a private message 58 fonts - 4,331,510 downloads 2,129 yesterday. Preview. Fonts 10 20 50 100. Show variants. Size Tiny Small Medium Large Sort by Name Popularity Newer first. More options. Only as. Public domain / GPL / OFL. 100% Free. Free for personal use. Donationware. Shareware. Demo. Unknown Only fonts with. Accents. Euro. Newcastle by Anthony Robinson. in Fancy. Decorative 15,200 downloads 4 yesterday. 100% Free - 2 font files Download Donate to author. Static Buzz by Anthony Robinson. in Fancy. Distorted 104,264 downloads 4 yesterday. 100% Free Download Donate to author. Lasso Of Truth by Anthony Robinson. in Gothic. Modern 5,855 downloads 4 yesterday. 100% Free Download Donate to author. Punched by An...
*  Anthony Robinson |
Anthony Robinson. English. Fran ais. Espa ol. Deutsch. Italiano. Portugu s Login. Register. Themes New fonts Authors Top Forum FAQ Submit a font Tools. 4 matching requests on the forum Anthony Robinson 1. 2 3. Anthony Robinson. View profile Send a private message 58 fonts - 4,333,980 downloads 2,470 yesterday. Preview. Fonts 10 20 50 100. Show variants. Size Tiny Small Medium Large Sort by Name Popularity Newer first Reinitialize More options. Only as. Public domain / GPL / OFL. 100% Free. Free for personal use. Donationware. Shareware. Demo. Unknown Only fonts with. Accents. Euro. First by Anthony Robinson. in Techno. Sci-fi 12,112 downloads 3 yesterday. 100% Free Download Donate to author. Newcastle by Anthony Robinson. in Fancy. Decorative 15,203 downloads 3 yesterday. 100% Free - 2 font files Download Donate to author. New York Punk by Anthony Robinson. in Fancy. Destroy 20,765 downloads 3 yesterday. 100% Free Download Donate to author. Lasso Of T...
*  Phillip Phillips Ringtones Free Download - Ringtone Maker Audiko
... Sublime, Kendrick Lamar, DevilDriver, K. Michelle, Five Finger Death Punch. Mobile apps. Login. JavaScript must be enabled in order for you to use Audiko in standard view. A B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T. U. V. W. X. Y. Z. 0...9. Thousands of ringtones on Here is a chance to download a free Phillip Phillips ringtones for your iPhone or mobile. Specify your favorite line from your favorite award-winning track - Beggin, Get Up Get Down, Unpack Your Heart, or any other track. You may download your ringtone both in the MP3 and m4a formats, supported by both mobile phones and iPhones. Just select a track, and choose free Phillip Phillips ringtones download option. Download Phillip Phillips Ringtones. Top free ringtones. Name. Gone, Gone, Gone. Home. Raging Fire. Alive Again. Face. Get Up Get Down. Searchlight. Volcano. U Got It Bad. We've Got Tonight. Albums. Behind the Light Deluxe Version. Phillip Phillips. Weve Got Tonight American Idol Performance Single. Phillip Phil...
*  Coles Phillips
... 'Clarence Coles Phillips' October 1880June 13, 1927 was an American artist and illustrator who signed his early works 'C. Coles Phillips', but after 1911 worked under the abbreviated name, 'Coles Phillips'. He is known for his stylish images of women and a signature use of negative space in the paintings he created for advertisements and the covers of popular magazines. Early life Career Personal life Notes References External links. Early life. ' ' Michael Schau, Watson-Guptill, 1975, p. Image:Coles Phillips2 Life.jpg The work of Phillips quickly became popular with the 'Life' readers. Schau & Phillips 1975, p. Phillips' use of negative space allowed the viewer to "fill-in" the image; it also reduced printing costs for the magazine, as "the novelty of the technique and the striking design qualities masked the fact that 'Life' was getting by with single color or two-color covers in a day when full-color covers were de rigueur for the better magazines". Phillips worked in watercolor and always painted fro...
*  Phillip Phillips News, Pictures, and Videos |
Idol Managers Claim John Mayer's ex-manager plotted to jack "American Idol" champ Phillip Phillips out from under his contract with the show -- according to a new lawsuit, but the bigger news is Phil is a READ MORE > - 9/21/2015 2:51 PM PDT. Phillip Phillips I Want to be Gone, Gone, Gone From My Idol Contract Phillip Phillips says "American Idol" producers are ruining his career ... American Idol Winner Phillip Phillips Mother Popped for DUI Phillip Phillips' mother Sheryl Phillips -- who appeared on several episodes of "American Idol" during Phillip's championship run last season -- was arrested for DUI earlier today, TMZ has READ MORE > - 963 days ago. READ MORE > - 1063 days ago. Phillip Phillips Family Idol Champ s Forcing Us To Sell Pawn Shop Phillip Phillips' family says the singer left them high and dry after winning "American Idol" -- refusing to help them out financially -- and now, they've been forced to sell their cherished READ MORE > - 1066 days ago. Phillip Phillips Crooks Smash In Pawn Shop, St...
In addition, enzymes of this embodiment will also comprise one or more of a leucine, threonine, a valine, or alanine at position 1,781 Am, a glycine at position l,785 Am, a proline at position l,786 Am, an asparagine at position 1,811 Am, a proline at position l,824 Am, a cysteine or glycine at position l,999 Am, a cysteine or arginine at position 2,027 ' Am, a glycine at position 2,039 Am, an asparagine at position 2,041 Am, a phenylalanine, isoleucine or leucine at position 2,049 Am, a valine at position 2,059 Am, a leucine at position 2,074 Am, a leucine, isoleucine, methionine or additional valine at position 2,075 Am, a glycine or threonine at position 2,078 Am, a phenylalanine at position 2,079 Am, a glutamic acid at position 2,080 Am, a deletion at position 2,080 Am, a deletion at position 2,081 Am, an arginine, tryptophan, phenylalanine, glycine, histidine, lysine, leucine, serine, threonine, or valine at position 2,088 Am, a glutamic acid at position 2,095 Am, an alanine or serine at position 2,096 A...
*  Bimolecular fluorescence complementation
This was achieved by dissecting GFP into C- and N-terminal GFP fragments. In addition, this study was the first report of an ' in vivo ' technique, now known as the bimolecular fluorescence complementation BiFC assay, to provide insight into the structural basis of protein complex formation through detection of fluorescence caused by the assembly of fluorescent reporter protein fragments tethered to interacting proteins. Generally, YFP is recommended to serve as the reporter protein, cleaved at residue 155 N-terminal consisting of residues 1–154 and C-terminal consisting of residues 155–238 or residue 173 in particular, as these sets of fragments are highly efficient in their complementation when fused to many interacting proteins and they produce low levels fluorescence when fused to non-interacting proteins. It is suggested that each target protein is fused to both the N- and C-terminal fragments of the fluorescent reporter protein in turn, and that the fragments are fused at each of the N- and C-terminal e...
*  Candice Olson Family Spaces ISBN 9781118276679 PDF epub | Candice Olson ebook | eBookMall
Candice Olson Family Spaces ISBN 9781118276679 PDF epub. Candice Olson ebook. eBookMall. Candice Olson Family Spaces. Candice Olson. Design : Interior Decorating. Digital Book format: ePub Adobe DRM. Buy ePub. List price: $ 19.99 Our price: $ 16.99. Popular TV star Candice Olson shows you how to create your dream family room Everybody wants their home's main living space to meet the needs of the whole family—and look great doing it. Chock full of tips and ideas, Candice Olson Family Spaces features hundreds of full-color, before-and-after photos of Candice's stunning family room makeovers. Explains how good design accommodates all members of the family and their daily activities Designs offer functionality, durability, and comfort without sacrificing style As a busy mother of two, Candice brings valuable insight to what a family really needs from the spaces they share Redecorating—or even just dreaming about decorating—can transform one's outlook on life, and Candice Olson Family Spaces is the catalyst to get...
*  Abner Phillips (1737-1813), p.2
Abner Phillips - Surry County, NC There were Phillips in Surry County, NC as early as 1771, according to tax lists. Lewis' Dist.: Abner PHILLIPS, 400 acres, 1 white poll. LEWIS to Abner PHILLIPS, 300 acres on north side of Yadkin River, east side Turkey Creek, for 75. LEWIS to Abner PHILLIPS, 100 acres on north side of Yadkin River at Turkey Creek, for 75. Phillips Dist.: Abner PHILLIPS, 400 acres, 2 white polls. 1790 Census, Surry Co., NC, p.186: ABNER PHILLIPS 3 white males under 16 2 white males over 16 3 white females no slaves Note: Abner's sons Cornelius PHILLIPS and Ephraim PHILLIPS are also listed in the 1790 Census of Surry Co., NC, p.183. 1800 Census, Surry Co., NC: ABNER PHILLIPS. 1810 Census, Surry Co., NC, p.193: ABNER PHILLIPS. In the name of God Amen this tenth day of November in year of our lord 1812 I ABNER PHILLIPS of Surry County State of North Carolina being sick and weak in Body but in perfect mind memory thanks be given to God For the Same Calling unto mind the mortality of my bo...
*  "Dear Abby" Advice Columnist Pauline Phillips Dead at 94 - Us Weekly
... US Weekly. News. Photos. Style. Beauty. Moms. Body. Entertainment. Subscribe. Give a Gift. Us Weekly. Newsletter. Subscribe. ADVERTISEMENT. "Dear Abby" Advice Columnist Pauline Phillips Dead at 94. Celebrity News. Jan. Tweet. Columnist Abigail Van Buren attends Friends Of Mario Cuomo Fundraiser Dinner on November 30, 1989 at the Sheraton Center in New York City. Newspapers -- and readers -- the world over lost an icon Wednesday, Jan. 16, after "Dear Abby" advice columnist Pauline Phillips died in Minneapolis at the age of 94. Phillips had suffered from Alzheimer's disease for years, but was still dishing out advice to readers as recently as 2002, though her daughter Jeanne took on co-authoring duties in the mid-1990s. PHOTOS: Stars we lost in 2012. Phillips, who wrote under the pen name Abigail Van Buren, shared advice on everything from dating to snoring spouses for more than 40 years to a readership of more than 90 million newspaper readers. "They gave her a bunch of letters, thinking that they would n...
*  Joanna Phillips | UCSF Medical Center
Joanna Phillips. UCSF Medical Center. About UCSF. Find a Doctor. Conditions Treatments. Conditions Treatments A-Z. Patient Education. Doctors. Find a Doctor. Getting to UCSF Medical Center. Careers at UCSF Medical Center. UCSF Medical Group. Home > Doctors > Joanna Phillips. Find a Doctor. Joanna Phillips, M.D. Joanna Phillips is a neuropathologist at UCSF Medical Center who helps diagnose neurologic disease through the examination of central nervous system tissue. As an academic neuropathologist, her goal is to improve the treatment of brain tumors through research and patient care. She completed a pathology residency at the University of Washington in Seattle, followed by a fellowship in neuropathology at UCSF. Phillips is a member of several professional organizations, including the American Society for Investigative Pathology, American Association of Neuropathologists, American Association for Cancer Research and Glycobiology Research and Training Program. Safaee M, Fakurnejad S, Bloch O, Clark AJ, Ivan M...
*  SMART: Secondary literature for GLUCA domain
smart secondary literature for gluca domain smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback secondary literature sources for gluca the following references were automatically generated lopez lc frazier ml su cj kumar a saunders gf mammalian pancreatic preproglucagon contains three glucagon related peptides proc natl acad sci u s a display abstract we have isolated cdna clones encoding bovine pancreatic preproglucagon twenty five putative preproglucagon clones were selected by screening clones of a fetal bovine pancreas cdna library with a synthetic oligodeoxynucleotide probe the probe was a mixture of synthetic base dna oligomers constructed to correspond to the six carboxyl terminal amino acids residues of mature glucagon restriction mapping of six of these clones suggested that they represented a single mrna species primary sequence analysis of one clone containing a base pair dna insert revealed tha...
*  viruses share common: Topics by
... Toggle navigation. Topics by Home. Site Map. Index. Alerts. Help. Contact Us. About. Sample records for viruses share common. 1 2. 3. 4. 5. . . To gain insights into the role and specificity of hepaciviral nonstructural protein 2 NS2, which is required for HCV polyprotein processing and particle morphogenesis, we investigated whether NS2 structural and functional features are conserved between HCV and GBV-B. We found that GBV-B NS2, like HCV NS2, has cysteine protease activity responsible for cleavage at the NS2/NS3 junction, and we experimentally confirmed the location of this junction within the viral polyprotein. A model for GBV-B NS2 membrane topology was experimentally established by determining the membrane association properties of NS2 segments fused to green fluorescent protein GFP and their nuclear magnetic resonance structures using synthetic peptides as well as by applying an N-glycosylation scanning approach. Similar glycosylation studies confirmed the HCV NS2 organization. Togeth... share common.html
*  VPR: Andrea Phillips thanks President Obama, military for her husband's rescue
... .  Archive Home . Home . Andrea Phillips thanks President Obama, military for her husband's rescue. 04/13/09 5:42PM By Ross Sneyd.  MP3 .  Download MP3 . AP Photo/Toby Talbot. Andrea Phillips is flanked by her son, Daniel, and daughter, Mariah. Host A day after her husband was rescued from Somali pirates, Andrea Phillips said she wanted to thank friends, officials and especially President Obama for their support during the crisis. In a short news conference in South Burlington today, Phillips also said she had also been able to speak with her husband by telephone. VPR's Ross Sneyd has more. Sneyd Andrea Phillips has had the flu since a day before her husband's capture - and she's just now recovering. Since last week, when it became clear that Richard Phillips had given himself up to the pirates to protect the crew on his Merchant Marine ship, she's stayed out of the spotlight. She said her husband got a laugh out of her condition, knowing that she would be appeari...
*  Protein superfamily
A 'protein superfamily' is the largest grouping clade of proteins for which common ancestry can be inferred see homology. Usually this common ancestry is based on structural alignment. and mechanistic similarity even though no sequence similarity is evident. 2 Superfamilies typically contain several protein families which show sequence similarity within the family. The term 'protein clan' is commonly used for protease superfamilies based on the MEROPS protease classification system. Identification Sequence homology. Structural homology. Mechanistic similarity. Evolutionary significance Examples Protein superfamily resources See also References. Sequence homology. sequence homology. Superfamily members typically show no detectable sequence homology. In the PA clan of protease s, for example, not a single residue is conserved through the superfamily, not even those in the catalytic triad. Conversely, the individual families that make up a superfamily are defined on the basis of their sequence alignment, for exa...
*  Publications | NEB
FEBS Lett. Proc.Natl.Acad.Sci.USA J Parasitol. Proteins Mol.Cell.Biol. CABIOS Glycobiology Proceeding of the Heartworm Symposium Biotechnology Biochemistry Parasitology Today Science Archaea A Laboratory Manual Parasitology Proc Natl Acad Sci Clinical and Diagnostic Laboratory Immunology Abstracts Of Papers Of The American Chemical Society Accountability in Research Genetic Analysis Biomolecular Engineering Enzymes and Proteins from Hyperthermophilic Microorganisms, Advs.Protein Chemistry Genetics Society of America Nuc.Acids Res. Protein Sci Proc. Nucleic Acids Research BMC Res Notes J Steroid Biochem Mol Biol World J. J Bacteriol Biotechnology Journal Biomedical Optics Express Nucleic Acids Res. Plant Cell Nature Chemistry Methods in Molecular Biology Mol Cell Biol. J Cell Sci BMC Microbiol Protein Cell Gene Ther Appl Microbiol Biotechnol Nat Biotechnol Front Physiol Appl Environ Microbiol Viruses Applications in Plant Sciences G3 Bethesda J Virol Anal Biochem AMB Express PLoS Pathog Curr Opin Chem Biol J B...
*  Publications | NEB
Proc.Natl.Acad.Sci.USA Molecular Paradigms for Eradicating Helmenthic Parasites Exp.Parasitol. Appl.Environ.Microbiol., Trop.Med.Parasitol. Proc.Natl.Acad.Sci.USA J Parasitol. CABIOS Glycobiology Proceeding of the Heartworm Symposium Biotechnology Biochemistry Parasitology Today Science Archaea A Laboratory Manual Parasitology Proc Natl Acad Sci Clinical and Diagnostic Laboratory Immunology Abstracts Of Papers Of The American Chemical Society Accountability in Research Genetic Analysis Biomolecular Engineering Enzymes and Proteins from Hyperthermophilic Microorganisms, Advs.Protein Chemistry Genetics Society of America Nuc.Acids Res. Biochem J. NY Proc.Natl.Acad.Sci. Nucleic Acids Research BMC Res Notes J Steroid Biochem Mol Biol World J. J Bacteriol Biotechnology Journal Biomedical Optics Express Nucleic Acids Res. Plant Cell Nature Chemistry Methods in Molecular Biology Mol Cell Biol. J Cell Sci BMC Microbiol Protein Cell Gene Ther Appl Microbiol Biotechnol Nat Biotechnol Front Physiol Appl Environ Microbio...
*  Publications | NEB
FEBS Lett. Proc.Natl.Acad.Sci.USA J Parasitol. CABIOS Glycobiology Proceeding of the Heartworm Symposium Biotechnology Biochemistry Parasitology Today Science Archaea A Laboratory Manual Parasitology Proc Natl Acad Sci Clinical and Diagnostic Laboratory Immunology Abstracts Of Papers Of The American Chemical Society Accountability in Research Genetic Analysis Biomolecular Engineering Enzymes and Proteins from Hyperthermophilic Microorganisms, Advs.Protein Chemistry Genetics Society of America Nuc.Acids Res. Nucleic Acids Research BMC Res Notes J Steroid Biochem Mol Biol World J. J Bacteriol Biotechnology Journal Biomedical Optics Express Nucleic Acids Res. Plant Cell Nature Chemistry Methods in Molecular Biology Mol Cell Biol. J Cell Sci BMC Microbiol Protein Cell Gene Ther Appl Microbiol Biotechnol Nat Biotechnol Front Physiol Appl Environ Microbiol Viruses Applications in Plant Sciences G3 Bethesda J Virol Anal Biochem AMB Express PLoS Pathog Curr Opin Chem Biol J Biol Eng Mol Biol Evol PLoS Genet Biology B...
*  Par stability determinant
... notoc the par stability determinant is a bp locus of the pad plasmid which encodes a type i toxin antitoxin system in enterococcus faecalis it was the first such plasmid addiction module to be found in gram positive bacteria the par locus contains two gene s fst which encodes a amino acid toxic protein and a gene for rnaii the small rna anti toxin which inhibits fst translation the two genes are found on opposite dna strands and share a region which is where they are thought to have an antisense interaction their rna secondary structure s have been predicted computationally the complementary regions appear to be presented on exposed loops for interaction par maintains pad by means of post segregational killing psk if a daughter cell does not inherit the par locus the unstable rnaii will quickly degrade leaving the long lived fst toxin to damage or kill the daughter cell see also references further reading external links see also hok sok system references further reading external links category antisense ...
*  Publications | NEB
Proc.Natl.Acad.Sci.USA J Parasitol. CABIOS Glycobiology Proceeding of the Heartworm Symposium Biotechnology Biochemistry Parasitology Today Science Archaea A Laboratory Manual Parasitology Proc Natl Acad Sci Clinical and Diagnostic Laboratory Immunology Abstracts Of Papers Of The American Chemical Society Accountability in Research Genetic Analysis Biomolecular Engineering Enzymes and Proteins from Hyperthermophilic Microorganisms, Advs.Protein Chemistry Genetics Society of America Nuc.Acids Res. Nucleic Acids Research BMC Res Notes J Steroid Biochem Mol Biol World J. J Bacteriol Biotechnology Journal Biomedical Optics Express Nucleic Acids Res. Plant Cell Nature Chemistry Methods in Molecular Biology Mol Cell Biol. J Cell Sci BMC Microbiol Protein Cell Gene Ther Appl Microbiol Biotechnol Nat Biotechnol Front Physiol Appl Environ Microbiol Viruses Applications in Plant Sciences G3 Bethesda J Virol Anal Biochem AMB Express PLoS Pathog Curr Opin Chem Biol J Biol Eng Mol Biol Evol PLoS Genet Biology Basel Front ...
*  Publications | NEB
Proc.Natl.Acad.Sci.USA J Parasitol. CABIOS Glycobiology Proceeding of the Heartworm Symposium Biotechnology Biochemistry Parasitology Today Science Archaea A Laboratory Manual Parasitology Proc Natl Acad Sci Clinical and Diagnostic Laboratory Immunology Abstracts Of Papers Of The American Chemical Society Accountability in Research Genetic Analysis Biomolecular Engineering Enzymes and Proteins from Hyperthermophilic Microorganisms, Advs.Protein Chemistry Genetics Society of America Nuc.Acids Res. Nucleic Acids Research BMC Res Notes J Steroid Biochem Mol Biol World J. J Bacteriol Biotechnology Journal Biomedical Optics Express Nucleic Acids Res. Plant Cell Nature Chemistry Methods in Molecular Biology Mol Cell Biol. J Cell Sci BMC Microbiol Protein Cell Gene Ther Appl Microbiol Biotechnol Nat Biotechnol Front Physiol Appl Environ Microbiol Viruses Applications in Plant Sciences G3 Bethesda J Virol Anal Biochem AMB Express PLoS Pathog Curr Opin Chem Biol J Biol Eng Mol Biol Evol PLoS Genet Biology Basel Front ...
*  Publications | NEB
Proc.Natl.Acad.Sci.USA J Parasitol. CABIOS Glycobiology Proceeding of the Heartworm Symposium Biotechnology Biochemistry Parasitology Today Science Archaea A Laboratory Manual Parasitology Proc Natl Acad Sci Clinical and Diagnostic Laboratory Immunology Abstracts Of Papers Of The American Chemical Society Accountability in Research Genetic Analysis Biomolecular Engineering Enzymes and Proteins from Hyperthermophilic Microorganisms, Advs.Protein Chemistry Genetics Society of America Nuc.Acids Res. Nucleic Acids Research BMC Res Notes J Steroid Biochem Mol Biol World J. J Bacteriol Biotechnology Journal Biomedical Optics Express Nucleic Acids Res. Plant Cell Nature Chemistry Methods in Molecular Biology Mol Cell Biol. J Cell Sci BMC Microbiol Protein Cell Gene Ther Appl Microbiol Biotechnol Nat Biotechnol Front Physiol Appl Environ Microbiol Viruses Applications in Plant Sciences G3 Bethesda J Virol Anal Biochem AMB Express PLoS Pathog Curr Opin Chem Biol J Biol Eng Mol Biol Evol PLoS Genet Biology Basel Front ...

Ligation-independent cloning: Ligation-independent cloning (LIC) is a form of molecular cloning that is able to be performed without the use of restriction endonucleases or DNA ligase. This allows genes that have restriction sites to be cloned without worry of chopping up the insert.Coles PhillipsProtein primary structure: The primary structure of a peptide or protein is the linear sequence of its amino acid structural units, and partly comprises its overall biomolecular structure. By convention, the primary structure of a protein is reported starting from the amino-terminal (N) end to the carboxyl-terminal (C) end.Symmetry element: A symmetry element is a point of reference about which symmetry operations can take place. In particular, symmetry elements can be centers of inversion, axes of rotation and mirror planes.CS-BLASTList of strains of Escherichia coli: Escherichia coli is a well studied bacterium that was first identified by Theodor Escherich, after whom it was later named.Library (biology): In molecular biology, a library is a collection of DNA fragments that is stored and propagated in a population of micro-organisms through the process of molecular cloning. There are different types of DNA libraries, including cDNA libraries (formed from reverse-transcribed RNA), genomic libraries (formed from genomic DNA) and randomized mutant libraries (formed by de novo gene synthesis where alternative nucleotides or codons are incorporated).DNA sequencer: A DNA sequencer is a scientific instrument used to automate the DNA sequencing process. Given a sample of DNA, a DNA sequencer is used to determine the order of the four bases: G (guanine), C (cytosine), A (adenine) and T (thymine).DNA condensation: DNA condensation refers to the process of compacting DNA molecules in vitro or in vivo. Mechanistic details of DNA packing are essential for its functioning in the process of gene regulation in living systems.Mature messenger RNA: Mature messenger RNA, often abbreviated as mature mRNA is a eukaryotic RNA transcript that has been spliced and processed and is ready for translation in the course of protein synthesis. Unlike the eukaryotic RNA immediately after transcription known as precursor messenger RNA, it consists exclusively of exons, with all introns removed.Triparental mating: Triparental mating is a form of Bacterial conjugation where a conjugative plasmid present in one bacterial strain assists the transfer of a mobilizable plasmid present in a second bacterial strain into a third bacterial strain. Plasmids are introduced into bacteria for such purposes as transformation, cloning, or transposon mutagenesis.Chromosome regionsThermal cyclerOpen reading frame: In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the potential to code for a protein or peptide. An ORF is a continuous stretch of codons that do not contain a stop codon (usually UAA, UAG or UGA).Restriction fragment: A restriction fragment is a DNA fragment resulting from the cutting of a DNA strand by a restriction enzyme (restriction endonucleases), a process called restriction. Each restriction enzyme is highly specific, recognising a particular short DNA sequence, or restriction site, and cutting both DNA strands at specific points within this site.Branching order of bacterial phyla (Gupta, 2001): There are several models of the Branching order of bacterial phyla, one of these was proposed in 2001 by Gupta based on conserved indels or protein, termed "protein signatures", an alternative approach to molecular phylogeny. Some problematic exceptions and conflicts are present to these conserved indels, however, they are in agreement with several groupings of classes and phyla.Multiple cloning site: A multiple cloning site (MCS), also called a polylinker, is a short segment of DNA which contains many (up to ~20) restriction sites - a standard feature of engineered plasmids. Restriction sites within an MCS are typically unique, occurring only once within a given plasmid.Eukaryotic transcription: Eukaryotic transcription is the elaborate process that eukaryotic cells use to copy genetic information stored in DNA into units of RNA replica. Gene transcription occurs in both eukaryotic and prokaryotic cells.ParaHox: The ParaHox gene cluster is an array of homeobox genes (involved in morphogenesis, the regulation of patterns of anatomical development) from the Gsx, Xlox (Pdx) and Cdx gene families.Molar mass distribution: In linear polymers the individual polymer chains rarely have exactly the same degree of polymerization and molar mass, and there is always a distribution around an average value. The molar mass distribution (or molecular weight distribution) in a polymer describes the relationship between the number of moles of each polymer species (Ni) and the molar mass (Mi) of that species.Ferric uptake regulator family: In molecular biology, the ferric uptake regulator (FUR) family of proteins includes metal ion uptake regulator proteins. These are responsible for controlling the intracellular concentration of iron in many bacteria.Silent mutation: Silent mutations are mutations in DNA that do not significantly alter the phenotype of the organism in which they occur. Silent mutations can occur in non-coding regions (outside of genes or within introns), or they may occur within exons.Specificity constant: In the field of biochemistry, the specificity constant (also called kinetic efficiency or k_{cat}/K_{M}), is a measure of how efficiently an enzyme converts substrates into products. A comparison of specificity constants can also be used as a measure of the preference of an enzyme for different substrates (i.Allele-specific oligonucleotide: An allele-specific oligonucleotide (ASO) is a short piece of synthetic DNA complementary to the sequence of a variable target DNA. It acts as a probe for the presence of the target in a Southern blot assay or, more commonly, in the simpler Dot blot assay.RNA transfection: RNA transfection is the process of deliberately introducing RNA into a living cell. RNA can be purified from cells after lysis or synthesized from free nucleotides either chemically, or enzymatically using an RNA polymerase to transcribe a DNA template.Avery–MacLeod–McCarty experimentMargaret Jope: Margaret Jope (1913–2004) was a Scottish biochemist, born as Henrietta Margaret Halliday in Peterhead, Scotland.YjdF RNA motifStreptomyces peucetius: Streptomyces peucetius ATCC 27952GC box: In molecular biology, a GC box is a distinct pattern of nucleotides found in the promoter region of some eukaryotic genes upstream of the TATA box and approximately 110 bases upstream from the transcription initiation site. It has a consensus sequence GGGCGG which is position dependent and orientation independent.Burst kinetics: Burst kinetics is a form of enzyme kinetics that refers to an initial high velocity of enzymatic turnover when adding enzyme to substrate. This initial period of high velocity product formation is referred to as the "Burst Phase".Zuotin: Z-DNA binding protein 1, also known as Zuotin, is a Saccharomyces cerevisiae yeast gene.Alternative splicing: Alternative splicing is a regulated process during gene expression that results in a single gene coding for multiple proteins. In this process, particular exons of a gene may be included within or excluded from the final, processed messenger RNA (mRNA) produced from that gene.Membrane protein: Membrane proteins are proteins that interact with biological membranes. They are one of the common types of protein along with soluble globular proteins, fibrous proteins, and disordered proteins.Translational regulation: Translational regulation refers to the control of the levels of protein synthesized from its mRNA. The corresponding mechanisms are primarily targeted on the control of ribosome recruitment on the initiation codon, but can also involve modulation of the elongation or termination of protein synthesis.Intron: right|thumbnail|270px|Representation of intron and [[exons within a simple gene containing a single intron.]]Beef cattle: Beef cattle are cattle raised for meat production (as distinguished from dairy cattle, used for milk production). The meat of adult cattle is known as beef.Composite transposon: A composite transposon is similar in function to simple transposons and Insertion Sequence (IS) elements in that it has protein coding DNA segments flanked by inverted, repeated sequences that can be recognized by transposase enzymes. A composite transposon, however, is flanked by two separate IS elements which may or may not be exact replicas.CpG OligodeoxynucleotideOperon: In genetics, an operon is a functioning unit of genomic DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo trans-splicing to create monocistronic mRNAs that are translated separately, i.Direct repeat: Direct repeats are a type of genetic sequence that consists of two or more repeats of a specific sequence.Baby hamster kidney cell: Baby Hamster Kidney fibroblasts (aka BHK cells) are an adherent cell line used in molecular biology.Isozyme: Isozymes (also known as isoenzymes or more generally as Multiple forms of enzymes) are enzymes that differ in amino acid sequence but catalyze the same chemical reaction. These enzymes usually display different kinetic parameters (e.Pituitary-specific positive transcription factor 1: POU domain, class 1, transcription factor 1 (Pit1, growth hormone factor 1), also known as POU1F1, is a transcription factor for growth hormone.Extension Poly(A) Test: The extension Poly(A) Test (ePAT) describes a method to determine the poly(A) tail lengths of mRNA molecules. It was developed and described by A.Phenotype microarray: The phenotype microarray approach is a technology for high-throughput phenotyping of cells.Signature-tagged mutagenesis: Signature-tagged mutagenesis (STM) is a genetic technique used to study gene function. Recent advances in genome sequencing have allowed us to catalogue a large variety of organisms' genomes, but the function of the genes they contain is still largely unknown.DNA-binding proteinAntitermination: Antitermination is the prokaryotic cell's aid to fix premature termination of RNA synthesis during the transcription of RNA. It occurs when the RNA polymerase ignores the termination signal, and it provides a mechanism whereby one or more genes at the end of an operon can be switched either on or off, depending on the polymerase either recognizing or not recognizing the termination signal.Liver sinusoid: A liver sinusoid is a type of sinusoidal blood vessel (with fenestrated, discontinuous endothelium) that serves as a location for the oxygen-rich blood from the hepatic artery and the nutrient-rich blood from the portal vein.SIU SOM Histology GIBacillus alcalophilus: Bacillus alcalophilus is a Gram-positive, rod-shaped species of bacteria. Likely strains of this species have been isolated from highly alkaline waste water.Circular bacterial chromosome: A circular bacterial chromosome is a bacterial chromosome in the form of a molecule of circular DNA. Unlike the linear DNA of most eukaryotes, typical bacterial chromosomes are circular.Lattice protein: Lattice proteins are highly simplified computer models of proteins which are used to investigate protein folding.

(1/69323) Novel regulation of the homeotic gene Scr associated with a crustacean leg-to-maxilliped appendage transformation.

Homeotic genes are known to be involved in patterning morphological structures along the antero-posterior axis of insects and vertebrates. Because of their important roles in development, changes in the function and expression patterns of homeotic genes may have played a major role in the evolution of different body plans. For example, it has been proposed that during the evolution of several crustacean lineages, changes in the expression patterns of the homeotic genes Ultrabithorax and abdominal-A have played a role in transformation of the anterior thoracic appendages into mouthparts termed maxillipeds. This homeotic-like transformation is recapitulated at the late stages of the direct embryonic development of the crustacean Porcellio scaber (Oniscidea, Isopoda). Interestingly, this morphological change is associated with apparent novelties both in the transcriptional and post-transcriptional regulation of the Porcellio scaber ortholog of the Drosophila homeotic gene, Sex combs reduced (Scr). Specifically, we find that Scr mRNA is present in the second maxillary segment and the first pair of thoracic legs (T1) in early embryos, whereas protein accumulates only in the second maxillae. In later stages, however, high levels of SCR appear in the T1 legs, which correlates temporally with the transformation of these appendages into maxillipeds. Our observations provide further insight into the process of the homeotic leg-to-maxilliped transformation in the evolution of crustaceans and suggest a novel regulatory mechanism for this process in this group of arthropods.  (+info)

(2/69323) Mrj encodes a DnaJ-related co-chaperone that is essential for murine placental development.

We have identified a novel gene in a gene trap screen that encodes a protein related to the DnaJ co-chaperone in E. coli. The gene, named Mrj (mammalian relative of DnaJ) was expressed throughout development in both the embryo and placenta. Within the placenta, expression was particularly high in trophoblast giant cells but moderate levels were also observed in trophoblast cells of the chorion at embryonic day 8.5, and later in the labyrinth which arises from the attachment of the chorion to the allantois (a process called chorioallantoic fusion). Insertion of the ROSAbetageo gene trap vector into the Mrj gene created a null allele. Homozygous Mrj mutants died at mid-gestation due to a failure of chorioallantoic fusion at embryonic day 8.5, which precluded formation of the mature placenta. At embryonic day 8.5, the chorion in mutants was morphologically normal and expressed the cell adhesion molecule beta4 integrin that is known to be required for chorioallantoic fusion. However, expression of the chorionic trophoblast-specific transcription factor genes Err2 and Gcm1 was significantly reduced. The mutants showed no abnormal phenotypes in other trophoblast cell types or in the embryo proper. This study indicates a previously unsuspected role for chaperone proteins in placental development and represents the first genetic analysis of DnaJ-related protein function in higher eukaryotes. Based on a survey of EST databases representing different mouse tissues and embryonic stages, there are 40 or more DnaJ-related genes in mammals. In addition to Mrj, at least two of these genes are also expressed in the developing mouse placenta. The specificity of the developmental defect in Mrj mutants suggests that each of these genes may have unique tissue and cellular activities.  (+info)

(3/69323) Requirement of a novel gene, Xin, in cardiac morphogenesis.

A novel gene, Xin, from chick (cXin) and mouse (mXin) embryonic hearts, may be required for cardiac morphogenesis and looping. Both cloned cDNAs have a single open reading frame, encoding proteins with 2,562 and 1,677 amino acids for cXin and mXin, respectively. The derived amino acid sequences share 46% similarity. The overall domain structures of the predicted cXin and mXin proteins, including proline-rich regions, 16 amino acid repeats, DNA-binding domains, SH3-binding motifs and nuclear localization signals, are highly conserved. Northern blot analyses detect a single message of 8.9 and 5.8 kilo base (kb) from both cardiac and skeletal muscle of chick and mouse, respectively. In situ hybridization reveals that the cXin gene is specifically expressed in cardiac progenitor cells of chick embryos as early as stage 8, prior to heart tube formation. cXin continues to be expressed in the myocardium of developing hearts. By stage 15, cXin expression is also detected in the myotomes of developing somites. Immunofluorescence microscopy reveals that the mXin protein is colocalized with N-cadherin and connexin-43 in the intercalated discs of adult mouse hearts. Incubation of stage 6 chick embryos with cXin antisense oligonucleotides results in abnormal cardiac morphogenesis and an alteration of cardiac looping. The myocardium of the affected hearts becomes thickened and tends to form multiple invaginations into the heart cavity. This abnormal cellular process may account in part for the abnormal looping. cXin expression can be induced by bone morphogenetic protein (BMP) in explants of anterior medial mesoendoderm from stage 6 chick embryos, a tissue that is normally non-cardiogenic. This induction occurs following the BMP-mediated induction of two cardiac-restricted transcription factors, Nkx2.5 and MEF2C. Furthermore, either MEF2C or Nkx2.5 can transactivate a luciferase reporter driven by the mXin promoter in mouse fibroblasts. These results suggest that Xin may participate in a BMP-Nkx2.5-MEF2C pathway to control cardiac morphogenesis and looping.  (+info)

(4/69323) Mechanisms of GDF-5 action during skeletal development.

Mutations in GDF-5, a member of the TGF-beta superfamily, result in the autosomal recessive syndromes brachypod (bp) in mice and Hunter-Thompson and Grebe-type chondrodysplasias in humans. These syndromes are all characterised by the shortening of the appendicular skeleton and loss or abnormal development of some joints. To investigate how GDF-5 controls skeletogenesis, we overexpressed GDF-5 during chick limb development using the retrovirus, RCASBP. This resulted in up to a 37.5% increase in length of the skeletal elements, which was predominantly due to an increase in the number of chondrocytes. By injecting virus at different stages of development, we show that GDF-5 can increase both the size of the early cartilage condensation and the later developing skeletal element. Using in vitro micromass cultures as a model system to study the early steps of chondrogenesis, we show that GDF-5 increases chondrogenesis in a dose-dependent manner. We did not detect changes in proliferation. However, cell suspension cultures showed that GDF-5 might act at these stages by increasing cell adhesion, a critical determinant of early chondrogenesis. In contrast, pulse labelling experiments of GDF-5-infected limbs showed that at later stages of skeletal development GDF-5 can increase proliferation of chondrocytes. Thus, here we show two mechanisms of how GDF-5 may control different stages of skeletogenesis. Finally, our data show that levels of GDF-5 expression/activity are important in controlling the size of skeletal elements and provides a possible explanation for the variation in the severity of skeletal defects resulting from mutations in GDF-5.  (+info)

(5/69323) Molecular cloning and epitope analysis of the peanut allergen Ara h 3.

Peanut allergy is a significant IgE-mediated health problem because of the increased prevalence, potential severity, and chronicity of the reaction. Following our characterization of the two peanut allergens Ara h 1 and Ara h 2, we have isolated a cDNA clone encoding a third peanut allergen, Ara h 3. The deduced amino acid sequence of Ara h 3 shows homology to 11S seed-storage proteins. The recombinant form of this protein was expressed in a bacterial system and was recognized by serum IgE from approximately 45% of our peanut-allergic patient population. Serum IgE from these patients and overlapping, synthetic peptides were used to map the linear, IgE-binding epitopes of Ara h 3. Four epitopes, between 10 and 15 amino acids in length, were found within the primary sequence, with no obvious sequence motif shared by the peptides. One epitope is recognized by all Ara h 3-allergic patients. Mutational analysis of the epitopes revealed that single amino acid changes within these peptides could lead to a reduction or loss of IgE binding. By determining which amino acids are critical for IgE binding, it might be possible to alter the Ara h 3 cDNA to encode a protein with a reduced IgE-binding capacity. These results will enable the design of improved diagnostic and therapeutic approaches for food-hypersensitivity reactions.  (+info)

(6/69323) TIF1gamma, a novel member of the transcriptional intermediary factor 1 family.

We report the cloning and characterization of a novel member of the Transcriptional Intermediary Factor 1 (TIF1) gene family, human TIF1gamma. Similar to TIF1alpha and TIF1beta, the structure of TIF1beta is characterized by multiple domains: RING finger, B boxes, Coiled coil, PHD/TTC, and bromodomain. Although structurally related to TIF1alpha and TIF1beta, TIF1gamma presents several functional differences. In contrast to TIF1alpha, but like TIF1beta, TIF1 does not interact with nuclear receptors in yeast two-hybrid or GST pull-down assays and does not interfere with retinoic acid response in transfected mammalian cells. Whereas TIF1alpha and TIF1beta were previously found to interact with the KRAB silencing domain of KOX1 and with the HP1alpha, MODI (HP1beta) and MOD2 (HP1gamma) heterochromatinic proteins, suggesting that they may participate in a complex involved in heterochromatin-induced gene repression, TIF1gamma does not interact with either the KRAB domain of KOX1 or the HP1 proteins. Nevertheless, TIF1gamma, like TIF1alpha and TIF1beta, exhibits a strong silencing activity when tethered to a promoter. Since deletion of a novel motif unique to the three TIF1 proteins, called TIF1 signature sequence (TSS), abrogates transcriptional repression by TIF1gamma, this motif likely participates in TIF1 dependent repression.  (+info)

(7/69323) Anopheles gambiae Ag-STAT, a new insect member of the STAT family, is activated in response to bacterial infection.

A new insect member of the STAT family of transcription factors (Ag-STAT) has been cloned from the human malaria vector Anopheles gambiae. The domain involved in DNA interaction and the SH2 domain are well conserved. Ag-STAT is most similar to Drosophila D-STAT and to vertebrate STATs 5 and 6, constituting a proposed ancient class A of the STAT family. The mRNA is expressed at all developmental stages, and the protein is present in hemocytes, pericardial cells, midgut, skeletal muscle and fat body cells. There is no evidence of transcriptional activation following bacterial challenge. However, bacterial challenge results in nuclear translocation of Ag-STAT protein in fat body cells and induction of DNA-binding activity that recognizes a STAT target site. In vitro treatment with pervanadate (vanadate and H2O2) translocates Ag-STAT to the nucleus in midgut epithelial cells. This is the first evidence of direct participation of the STAT pathway in immune responses in insects.  (+info)

(8/69323) In vivo expression of the nucleolar group I intron-encoded I-dirI homing endonuclease involves the removal of a spliceosomal intron.

The Didymium iridis DiSSU1 intron is located in the nuclear SSU rDNA and has an unusual twin-ribozyme organization. One of the ribozymes (DiGIR2) catalyses intron excision and exon ligation. The other ribozyme (DiGIR1), which along with the endonuclease-encoding I-DirI open reading frame (ORF) is inserted in DiGIR2, carries out hydrolysis at internal processing sites (IPS1 and IPS2) located at its 3' end. Examination of the in vivo expression of DiSSU1 shows that after excision, DiSSU1 is matured further into the I-DirI mRNA by internal DiGIR1-catalysed cleavage upstream of the ORF 5' end, as well as truncation and polyadenylation downstream of the ORF 3' end. A spliceosomal intron, the first to be reported within a group I intron and the rDNA, is removed before the I-DirI mRNA associates with the polysomes. Taken together, our results imply that DiSSU1 uses a unique combination of intron-supplied ribozyme activity and adaptation to the general RNA polymerase II pathway of mRNA expression to allow a protein to be produced from the RNA polymerase I-transcribed rDNA.  (+info)

Cloned foods in the United States: How do you feel about it?

Does anyone else find it I find it ironic that the United States has considered cloning and stem cell research unethical; yet the FDA has no problem providing the citizens of this country with cloned products. 

It's not ok to research it, yet it's ok to eat it? Is that what I'm getting?

How do you guys feel about the FDA's statement to release cloned food products into our country's food supply?
I should be more clear on that: not necessarily the US's position, but Bush's.

The USDA,FDA,EPA all have lobbyists for the meat industry.They protect the industry,not the consumer.Just to let you know,the USDA tests less than 1% of the animals killed for food.Alisa Harrison was the spokesperson for the National Cattleman's Beef Association for fifteen years,she is now the working for the USDA as a high up secretary.

The FDA's draft assesment to approve cloned meat and milk relied heavily on research carried out by Cyagra and Viagen,two big animal cloning companies.That is like tobacco companies trying to tell you that cigarettes are safe,it wasn't even carried out by a third party study.

It is has been found that 60% of the public does not want to eat from cloned animals,yet the FDA has stated that it cannot require labeling.This situaion has already happened before,in 1995 the Bush Administration approved for the sale of genetically modified foods for human consumption,it didn't not require labeling either.Why?Their reason was that no one would buy it if they knew.That just goes to show you that they are protecting the industry,not the consumers.I'm really not shocked by this,but many people don't about the industry or where their food comes from.

~The USDA Food Guide Pyramid available through 2005 recommended that meat, poultry, fish, and eggs comprise 14% of the diet, yet 52% of USDA food promotion resources were allocated to these foods.  The Pyramid said 33% of the diet should come from fruits and vegetables — which received only 5% of the USDA promotion budget.
--Produce for Better Health Foundation

~France,which only has a fraction of the U.S. cattle population,has tested more cattle in a single week than the U.S. tested in an entire decade!

~According to Europe's latest annual report,it is testing at a rate 2,000 times that of the U.S.

What is book that explains on a molecular neurological µbiological level how antipsychotic drugs work?

Title of a book that explains in detail (on a molecular and neuroligical) level how psychiatric drugs have the affect that they do on the brain tissue and what the long lasting effects could be ?

Maybe a neuropsychiatry textbook.

How do I start cooking with Molecular Gastronomy?

I have been cooking for years now, and I want to step it up to the next level and start cooking with molecular gastronomy. 

Where is a good place to start? 


Cloning Belgian beer. How do you add the rock candy when bottling?

I'm cloning a Belgian beer, but do not have specific instructions regarding how to add the rock candy and the corn sugar. Do I need to dissolve it and then add it immediately before bottling? If so, is there a specific amount of water to use?

It is best to dissolve the sugar in some water.  Use just enough water to make a syrup and not a watery mess.  Let it lightly boil for ten minutes to sanitize and dissolve it.  Pour this to your racked beer and mix gently before bottling.  

Good luck

cloning pancreas should be a priority with all the diabetics is it anywere in USA?

I do not see anyone rushing to the aid of those who could benefit from only organ cloning. IS anyone in the USA doing this for real? I have see the ear on the mouse and wonder when they will do something practical.

I haven't heard about this, but I think any diabetes research is taking a longer time because most of the general public does not understand what diabetes is.  Most people have a mental image of a type 2 diabetic, and it's is mostly wrong.

What should I wear for my presentation for my molecular cell biology class?

 I'd like opinions on what I should wear. I feel as though my dresses are either too casual, or too professional for a 1/2 hour presentation for my college molecular cell class. I'd prefer to shop at jc penny, wet seal, charlotte russe, or macys. Thanks!

Business casual. For my presentations for school I wear a nice simple blouse (plain color) nothing to flashy, a pair of slacks, and flats.

Does oil change its molecular structure when in high temperatures?

I heard that different oils (olive, sunflower etc) react differently to heat and some end up being much less healthier cooked than in the 'bottled' form. The molecular structure changes to this and that. So I would like to know whether this is really the case and most importantly with what oils this is the case.

Different oils have different smoking points. When oil is heated beyond the smoking point, it burns. Burning converts the oil to carbon dioxide and water, but often, incomplete combustion leaves behind other products that affect the flavor and nutritional quality.

Olive oils have a low smoking point, so they can't tolerate prolonged heating. Quick sautes are fine, but you wouldn't want to use them for frying.

Discussion: What are the relevant social, ethical, legal and economic effects of therapeutic cloning?

A technique has been developed, known as “Therapeutic Cloning”, in which an embryo is created to harvest stem cells, to be used, for example, to replace injured or faulty cells and restore the health of many people that are suffering from diseases that were once thought to be untreatable.

An embryo is a baby. I believe that is wrong. But I'm in a quandary, My first grandchild was born without a hand and she didn't have feet after countless surgeries, (around 30) the doctors built her feet from her own body, after circulation took (and it doesn't always) they moved bones in her body and built her feet. She is ten today and runs on her own feet what a miracle!!! But her hand they couldn't do anything about. Now I have seen that they a developing a type of cloning from your own body where you can re-grow a missing limb.they are years away on this research. But in good conscience if this was out now how could someone allow the doctors to cut off a limb so that you can regrow it.Especially a child. The pain alone would be horrible to put someone through yet it would improve the future of the physically handicapped.