Archaea: One of the three domains of life (the others being BACTERIA and Eukarya), formerly called Archaebacteria under the taxon Bacteria, but now considered separate and distinct. They are characterized by: (1) the presence of characteristic tRNAs and ribosomal RNAs; (2) the absence of peptidoglycan cell walls; (3) the presence of ether-linked lipids built from branched-chain subunits; and (4) their occurrence in unusual habitats. While archaea resemble bacteria in morphology and genomic organization, they resemble eukarya in their method of genomic replication. The domain contains at least four kingdoms: CRENARCHAEOTA; EURYARCHAEOTA; NANOARCHAEOTA; and KORARCHAEOTA.Archaeal Proteins: Proteins found in any species of archaeon.Genes, Archaeal: The functional genetic units of ARCHAEA.DNA, Archaeal: Deoxyribonucleic acid that makes up the genetic material of archaea.RNA, Archaeal: Ribonucleic acid in archaea having regulatory and catalytic roles as well as involvement in protein synthesis.Genome, Archaeal: The genetic complement of an archaeal organism (ARCHAEA) as represented in its DNA.Crenarchaeota: A kingdom in the domain ARCHAEA comprised of thermoacidophilic, sulfur-dependent organisms. The two orders are SULFOLOBALES and THERMOPROTEALES.Gene Expression Regulation, Archaeal: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in archaea.Haloferax volcanii: A species of halophilic archaea found in the Dead Sea.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Methane: The simplest saturated hydrocarbon. It is a colorless, flammable gas, slightly soluble in water. It is one of the chief constituents of natural gas and is formed in the decomposition of organic matter. (Grant & Hackh's Chemical Dictionary, 5th ed)Methanococcus: A genus of anaerobic coccoid METHANOCOCCACEAE whose organisms are motile by means of polar tufts of flagella. These methanogens are found in salt marshes, marine and estuarine sediments, and the intestinal tract of animals.Bacteria: One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.Sulfolobus: A genus of aerobic, chemolithotrophic, coccoid ARCHAEA whose organisms are thermoacidophilic. Its cells are highly irregular in shape, often lobed, but occasionally spherical. It has worldwide distribution with organisms isolated from hot acidic soils and water. Sulfur is used as an energy source.Methanobacteriaceae: A family of anaerobic, coccoid to rod-shaped METHANOBACTERIALES. Cell membranes are composed mainly of polyisoprenoid hydrocarbons ether-linked to glycerol. Its organisms are found in anaerobic habitats throughout nature.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Euryarchaeota: A phylum of ARCHAEA comprising at least seven classes: Methanobacteria, Methanococci, Halobacteria (extreme halophiles), Archaeoglobi (sulfate-reducing species), Methanopyri, and the thermophiles: Thermoplasmata, and Thermococci.Methanosarcina: A genus of anaerobic, irregular spheroid-shaped METHANOSARCINALES whose organisms are nonmotile. Endospores are not formed. These archaea derive energy via formation of methane from acetate, methanol, mono-, di-, and trimethylamine, and possibly, carbon monoxide. Organisms are isolated from freshwater and marine environments.Nitrification: A process facilitated by specialized bacteria involving the oxidation of ammonium to nitrite and nitrate.Methanobacterium: A genus of anaerobic, rod-shaped METHANOBACTERIACEAE. Its organisms are nonmotile and use ammonia as the sole source of nitrogen. These methanogens are found in aquatic sediments, soil, sewage, and the gastrointestinal tract of animals.Desulfurococcaceae: A family of archaea, in the order DESULFUROCOCCALES, consisting of anaerobic cocci which utilize peptides, proteins or carbohydrates facultatively by sulfur respiration or fermentation. There are eight genera: AEROPYRUM, Desulfurococcus, Ignicoccus, Staphylothermus, Stetteria, Sulfophoboccus, Thermodiscus, and Thermosphaera. (From Bergey's Manual of Systematic Bacteriology, 2d ed)Methanosarcinales: An order of anaerobic methanogens in the kingdom EURYARCHAEOTA. There are two families: METHANOSARCINACEAE and Methanosaetaceae.Halobacteriales: An order of extremely halophilic archaea, in the kingdom EURYARCHAEOTA. They occur ubiquitously in nature where the salt concentration is high, and are chemoorganotrophic, using amino acids or carbohydrates as a carbon source.Haloferax: A genus of extremely halophilic HALOBACTERIACEAE which are chemoheterotropic and strictly aerobic. They are found in neutral saline environments such as salt lakes (especially the Dead Sea) and marine salterns.Pyrococcus: A genus of strictly anaerobic ultrathermophilic archaea, in the family THERMOCOCCACEAE, occurring in heated seawaters. They exhibit heterotrophic growth at an optimum temperature of 100 degrees C.Sulfolobus acidocaldarius: A species of aerobic, chemolithotrophic ARCHAEA consisting of coccoid cells that utilize sulfur as an energy source. The optimum temperature for growth is 70-75 degrees C. They are isolated from acidic fields.RNA, Ribosomal, 16S: Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.Methanosarcinaceae: A family of anaerobic METHANOSARCINALES whose cells are mesophilic or thermophilic and appear as irregular spheroid bodies or sheathed rods. These methanogens are found in any anaerobic environment including aquatic sediments, anaerobic sewage digesters and gastrointestinal tracts. There are four genera: METHANOSARCINA, Methanolobus, Methanothrix, and Methanococcoides.Pyrococcus abyssi: A species of gram-negative hyperthermophilic ARCHAEA found in deep ocean hydrothermal vents. It is an obligate anaerobe and obligate chemoorganotroph.Chromosomes, Archaeal: Structures within the nucleus of archaeal cells consisting of or containing DNA, which carry genetic information essential to the cell.Sulfolobus solfataricus: A species of thermoacidophilic ARCHAEA in the family Sulfolobaceae, found in volcanic areas where the temperature is about 80 degrees C and SULFUR is present.Geologic Sediments: A mass of organic or inorganic solid fragmented material, or the solid fragment itself, that comes from the weathering of rock and is carried by, suspended in, or dropped by air, water, or ice. It refers also to a mass that is accumulated by any other natural agent and that forms in layers on the earth's surface, such as sand, gravel, silt, mud, fill, or loess. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1689)Methanococcales: An order of anaerobic methanogens in the kingdom EURYARCHAEOTA. They are pseudosarcina, coccoid or sheathed rod-shaped and catabolize methyl groups. The cell wall is composed of protein. The order includes one family, METHANOCOCCACEAE. (From Bergey's Manual of Systemic Bacteriology, 1989)Archaeoglobus fulgidus: A species of extremely thermophilic, sulfur-reducing archaea. It grows at a maximum temperature of 95 degrees C. in marine or deep-sea geothermal areas.Pyrococcus furiosus: A species of strictly anaerobic, hyperthermophilic archaea which lives in geothermally-heated marine sediments. It exhibits heterotropic growth by fermentation or sulfur respiration.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Seawater: The salinated water of OCEANS AND SEAS that provides habitat for marine organisms.Thermococcus: A genus of extremely thermophilic heterotrophic archaea, in the family THERMOCOCCACEAE, occurring in heated sea flows. They are anaerobic chemoorganotropic sulfidogens.Eukaryotic Cells: Cells of the higher organisms, containing a true nucleus bounded by a nuclear membrane.Methanosarcina barkeri: A species of halophilic archaea whose organisms are nonmotile. Habitats include freshwater and marine mud, animal-waste lagoons, and the rumens of ungulates.Halobacteriaceae: A family of extremely halophilic archaea found in environments with high salt concentrations, such as salt lakes, evaporated brines, or salted fish. Halobacteriaceae are either obligate aerobes or facultative anaerobes and are divided into at least twenty-six genera including: HALOARCULA; HALOBACTERIUM; HALOCOCCUS; HALOFERAX; HALORUBRUM; NATRONOBACTERIUM; and NATRONOCOCCUS.Ammonia: A colorless alkaline gas. It is formed in the body during decomposition of organic materials during a large number of metabolically important reactions. Note that the aqueous form of ammonia is referred to as AMMONIUM HYDROXIDE.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Archaeal Viruses: Viruses whose hosts are in the domain ARCHAEA.Glyceryl Ethers: Compounds in which one or more of the three hydroxyl groups of glycerol are in ethereal linkage with a saturated or unsaturated aliphatic alcohol; one or two of the hydroxyl groups of glycerol may be esterified. These compounds have been found in various animal tissue.Eukaryota: One of the three domains of life (the others being BACTERIA and ARCHAEA), also called Eukarya. These are organisms whose cells are enclosed in membranes and possess a nucleus. They comprise almost all multicellular and many unicellular organisms, and are traditionally divided into groups (sometimes called kingdoms) including ANIMALS; PLANTS; FUNGI; and various algae and other taxa that were previously part of the old kingdom Protista.Thermoplasma: A genus of facultatively anaerobic heterotrophic archaea, in the order THERMOPLASMALES, isolated from self-heating coal refuse piles and acid hot springs. They are thermophilic and can grow both with and without sulfur.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.DNA, Ribosomal: DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Autotrophic Processes: The processes by which organisms use simple inorganic substances such as gaseous or dissolved carbon dioxide and inorganic nitrogen as nutrient sources. Contrasts with heterotrophic processes which make use of organic materials as the nutrient supply source. Autotrophs can be either chemoautotrophs (or chemolithotrophs), largely ARCHAEA and BACTERIA, which also use simple inorganic substances for their metabolic energy reguirements; or photoautotrophs (or photolithotrophs), such as PLANTS and CYANOBACTERIA, which derive their energy from light. Depending on environmental conditions some organisms can switch between different nutritional modes (autotrophy; HETEROTROPHY; chemotrophy; or PHOTOTROPHY) to utilize different sources to meet their nutrient and energy requirements.Haloferax mediterranei: A species of halophilic archaea found in the Mediterranean Sea. It produces bacteriocins active against a range of other halobacteria.Prokaryotic Cells: Cells lacking a nuclear membrane so that the nuclear material is either scattered in the cytoplasm or collected in a nucleoid region.Thermoproteaceae: A family of THERMOPROTEALES consisting of variable length rigid rods without septa. They grow either chemolithoautotrophically or by sulfur respiration. The four genera are: PYROBACULUM; THERMOPROTEUS; Caldivirga; and Thermocladium. (From Bergey's Manual of Systematic Bacteriology, 2d ed)Halobacterium salinarum: A species of halophilic archaea found in salt lakes. Some strains form a PURPLE MEMBRANE under anaerobic conditions.Biodiversity: The variety of all native living organisms and their various forms and interrelationships.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Thermoplasmales: An order of aerobic, thermophilic archaea, in the kingdom EURYARCHAEOTA, characterized by the absence of a cell wall. Two genera have been described: THERMOPLASMA and Picrophilus.Gene Transfer, Horizontal: The naturally occurring transmission of genetic information between organisms, related or unrelated, circumventing parent-to-offspring transmission. Horizontal gene transfer may occur via a variety of naturally occurring processes such as GENETIC CONJUGATION; GENETIC TRANSDUCTION; and TRANSFECTION. It may result in a change of the recipient organism's genetic composition (TRANSFORMATION, GENETIC).Methanobrevibacter: A genus of gram-positive, anaerobic, cocci to short rod-shaped ARCHAEA, in the family METHANOBACTERIACEAE, order METHANOBACTERIALES. They are found in the GASTROINTESTINAL TRACT or other anoxic environments.Bacterial Proteins: Proteins found in any species of bacterium.Haloarcula marismortui: A species of halophilic archaea distinguished by its production of acid from sugar. This species was previously called Halobacterium marismortui.Genes, rRNA: Genes, found in both prokaryotes and eukaryotes, which are transcribed to produce the RNA which is incorporated into RIBOSOMES. Prokaryotic rRNA genes are usually found in OPERONS dispersed throughout the GENOME, whereas eukaryotic rRNA genes are clustered, multicistronic transcriptional units.Genome, Bacterial: The genetic complement of a BACTERIA as represented in its DNA.Sulfolobales: An order of CRENARCHAEOTA consisting of aerobic or facultatively aerobic, chemolithotrophic cocci which are extreme thermoacidophiles. They lack peptidoglycan in their cell walls.Oxidoreductases: The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Water Microbiology: The presence of bacteria, viruses, and fungi in water. This term is not restricted to pathogenic organisms.Methanomicrobiaceae: A family of anaerobic METHANOMICROBIALES whose cells are coccoid to straight or slightly curved rods. There are six genera.Ecosystem: A functional system which includes the organisms of a natural community together with their environment. (McGraw Hill Dictionary of Scientific and Technical Terms, 4th ed)Archaeoglobus: A genus of extremely thermophilic, sulfate-reducing archaea, in the family Archaeoglobaceae.Anaerobiosis: The complete absence, or (loosely) the paucity, of gaseous or dissolved elemental oxygen in a given place or environment. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)RNA, Transfer: The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Salinity: Degree of saltiness, which is largely the OSMOLAR CONCENTRATION of SODIUM CHLORIDE plus any other SALTS present. It is an ecological factor of considerable importance, influencing the types of organisms that live in an ENVIRONMENT.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Soil Microbiology: The presence of bacteria, viruses, and fungi in the soil. This term is not restricted to pathogenic organisms.Plankton: Community of tiny aquatic PLANTS and ANIMALS, and photosynthetic BACTERIA, that are either free-floating or suspended in the water, with little or no power of locomotion. They are divided into PHYTOPLANKTON and ZOOPLANKTON.Oxidation-Reduction: A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.Ribosome Subunits, Large, Archaeal: The large subunit of the archaeal 70s ribosome. It is composed of the 23S RIBOSOMAL RNA, the 5S RIBOSOMAL RNA, and about 40 different RIBOSOMAL PROTEINS.Sulfolobaceae: A family of SULFOLOBALES consisting of aerobic or facultatively anaerobic chemolithotrophic cocci, usually occurring singly. They grow best at a pH of about 2.Bioreactors: Tools or devices for generating products using the synthetic or chemical conversion capacity of a biological system. They can be classical fermentors, cell culture perfusion systems, or enzyme bioreactors. For production of proteins or enzymes, recombinant microorganisms such as bacteria, mammalian cells, or insect or plant cells are usually chosen.Hot Temperature: Presence of warmth or heat or a temperature notably higher than an accustomed norm.Hydrothermal Vents: Hot springs on the ocean floor. They are commonly found near volcanically active places such as mid-oceanic ridges.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Proteobacteria: A phylum of bacteria consisting of the purple bacteria and their relatives which form a branch of the eubacterial tree. This group of predominantly gram-negative bacteria is classified based on homology of equivalent nucleotide sequences of 16S ribosomal RNA or by hybridization of ribosomal RNA or DNA with 16S and 23S ribosomal RNA.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Pacific OceanGenes, Bacterial: The functional hereditary units of BACTERIA.Deltaproteobacteria: A group of PROTEOBACTERIA represented by morphologically diverse, anaerobic sulfidogens. Some members of this group are considered bacterial predators, having bacteriolytic properties.Biota: The spectrum of different living organisms inhabiting a particular region, habitat, or biotope.Sulfur: An element that is a member of the chalcogen family. It has an atomic symbol S, atomic number 16, and atomic weight [32.059; 32.076]. It is found in the amino acids cysteine and methionine.Haloarcula: A genus of HALOBACTERIACEAE distinguished from other genera in the family by the presence of specific derivatives of TGD-2 polar lipids. Haloarcula are found in neutral saline environments such as salt lakes, marine salterns, and saline soils.Microbial Consortia: A group of different species of microorganisms that act together as a community.Metagenomics: The genomic analysis of assemblages of organisms.Hot Springs: Habitat of hot water naturally heated by underlying geologic processes. Surface hot springs have been used for BALNEOLOGY. Underwater hot springs are called HYDROTHERMAL VENTS.Bacterial Physiological Phenomena: Physiological processes and properties of BACTERIA.Sulfur-Reducing Bacteria: A group of gram-negative, anaerobic bacteria that is able to oxidize acetate completely to carbon dioxide using elemental sulfur as the electron acceptor.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Estuaries: A partially enclosed body of water, and its surrounding coastal habitats, where saltwater from the ocean mixes with fresh water from rivers or streams. The resulting mixture of seawater and fresh water is called brackish water and its salinity can range from 0.5 to 35 ppt. (accessed http://oceanservice.noaa.gov/education/kits/estuaries/estuaries01_whatis.html)Nanoarchaeota: A kingdom of hyperthermophilic ARCHAEA found in diverse environments.Pyrococcus horikoshii: Anaerobic hyperthermophilic species of ARCHAEA, isolated from hydrothermal fluid samples. It is obligately heterotrophic with coccoid cells that require TRYPTOPHAN for growth.Methanomicrobiales: An order of anaerobic, highly specialized methanogens, in the kingdom EURYARCHAEOTA. Its organisms are nonmotile or motile, with cells occurring as coccoid bodies, pseudosarcina, or rods. Families include METHANOMICROBIACEAE, Methanocorpusculaceae, and Methanospirillaceae.Pyrobaculum: A genus of rod-shaped, almost rectangular ARCHAEA, in the family THERMOPROTEACEAE. Organisms are facultatively aerobic or strictly anaerobic, grow on various organic substrates, and are found in continental solfataras.Lakes: Inland bodies of still or slowly moving FRESH WATER or salt water, larger than a pond, and supplied by RIVERS and streams.Crystallography, X-Ray: The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Thermoproteus: A genus of obligately anaerobic ARCHAEA, in the family THERMOPROTEACEAE. They are found in acidic hot springs and water holes.Aeropyrum: A genus of anaerobic, chemolithotropic coccoid ARCHAEA, in the family DESULFUROCOCCACEAE. They live in marine environments.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.Heterotrophic Processes: The processes by which organisms utilize organic substances as their nutrient sources. Contrasts with AUTOTROPHIC PROCESSES which make use of simple inorganic substances as the nutrient supply source. Heterotrophs can be either chemoheterotrophs (or chemoorganotrophs) which also require organic substances such as glucose for their primary metabolic energy requirements, or photoheterotrophs (or photoorganotrophs) which derive their primary energy requirements from light. Depending on environmental conditions some organisms can switch between different nutritional modes (AUTOTROPHY; heterotrophy; chemotrophy; or PHOTOTROPHY) to utilize different sources to meet their nutrients and energy requirements.

*  Discover Life -- Tree of Life
life bacteria archaea eukaryotes alveolates...
http://discoverlife.org/mp/20m?tree=2&res=1200
*  Archaea
Archaea. About Microbiology. Login. Join. ... Types of Microbes. Archaea. How They're Different. ... Early Origins. Archaea of Note. What They Look Like. Where ... Archaea. About Microbiology. Join. All Content News Video Images Resources My Collections Submissions Tags. MicrobeWorld. About Microbiology What is a Microbe. Types of Microbes. Archaea. Bacteria. Fungi. Protista. Microbial Mergers. Interesting Facts. Careers in Microbiology. History of Microbiology. Classroom Experiments. Washup.org. Podcasts & Videos. Click for more " Microbes After Hours " videos. Join MicrobeWorld. Types of Microbes. Archaea. Types of Microbes. Archaea. Archaea Archaea. Among these three main types of archaea are some subtypes, which include:. Halophiles hal-oh-files — those archaeans that live in salty environments. Thermophiles ther-mo-files — the archaeans that live at extremely hot temperatures. Archaea look and act a lot like bacteria. So different Woese decided they deserved their own special branch on the...
http://microbeworld.org/index.php?option=com_content&view=article&id=149&Itemid=67
*  USGS: Science Topics: archaea
: Science Topics: archaea. . USGS Home Contact USGS Search USGS ... Organisms. Help. Archaea Microscopic organisms of the domain Archaea living on a diet of hydrogen and carbon...
http://usgs.gov/science/science.php?term=56
*  Recent Articles | Adeno-associated Virus, Microbiology And Ecology | The Scientist Magazine®| Page
Sea Viruses Destroy Archaea. Viruses are responsible for the ... majority of archaea deaths on the deep ocean floors,...
http://the-scientist.com/?articles.list/tagNo/3064,10,7/tags/adeno-associated-virus,microbiology,ecology/pageNo/2/
*  Recent Articles | Monoclonal Antibodies And Ecology | The Scientist Magazine®
for the majority of archaea deaths on the deep ocean floors,...
http://the-scientist.com/?articles.list/categoryNo/2625/category/The-Scientist/tagNo/2097,7/tags/monoclonal-antibodies,ecology/
*  Scientists Discover Analog for Extraterrestrial Life in Idaho Hot Spring
organisms known as Archaea thriving deep in the subsurface source ... spring in Idaho. Archaea , a class of microscopic organisms that ... decaying plants , Archaea live on a diet of hydrogen and carbon ... Scientists Discover Analog for Extraterrestrial Life in Idaho Hot Spring. Science Features All USGS. Scientists Discover Analog for Extraterrestrial Life in Idaho Hot Spring U.S. The scientists discovered a unique community of microscopic organisms known as Archaea thriving deep in the subsurface source of a hot spring in Idaho. Archaea Illustration The methods that were developed to study the fluids and microorganisms, including Archaea, in the hot spring area are presently being used by the USGS Toxic Substances Hydrology Program to study the biodegradation of a chlorinated solvent spill in fractured rock at the Naval Air Warfare Center NAWC Research Site , West Trenton, NJ. Information on Toxics Program Fractured Rock Investigations Geochemical and Microbiological Processes that Affect Migration an...
http://toxics.usgs.gov/highlights/archaea.html
*  16S ribosomal RNA sequences (Bacteria and Archaea) - Bioinformatics and Biostatistics
Bacteria and Archaea - Bioinformatics and Biostatistics. 16S ... Bacteria and Archaea - May/14/2013 Visit this topic in live ... Bacteria and Archaea " database contains DNA sequences of...
http://protocol-online.org/biology-forums-2/posts/29288.html
*  Some Deep-Sea Microbes Are Hungry For Rocket Fuel | Public Radio Tulsa
creatures called Archaea , and they can survive without oxygen. ... think that these Archaea cells may resemble the earliest forms ... seen and studied Archaea is a bug called Archaeoglobus fulgidus...
http://publicradiotulsa.org/post/some-deep-sea-microbes-are-hungry-rocket-fuel
*  What is a Microbe?
six main types: Archaea , Bacteria , Fungi , Protista , Viruses ... cousins the archaea were the earliest forms of life on ... Earth. Many archaeans thrive in conditions that would kill...
http://microbeworld.org/what-is-a-microbe/42-what-is-a-microbe-sp-828/types-of-microbes
*  Genome Atlas - 3.0 (beta)
Other Archaea. Classification of phyla is from NCBI...
http://cbs.dtu.dk/services/GenomeAtlas-3.0/?action=accd&acc=CP001858&pid=32583&pt=g&ph=3&k=Archaea&tag=HWE_HK_HMMSEARCH
*  Kingdom Archaea
... Course Schedule Plant Phys Info Homepagexx Email Ross Koning. Kingdom Archaea. Clickable Index of Archaea Cellular Structure Homeostasis Growth Movement Reproduction Response Evolution. You have learned that living organisms have at least seven unique properties listed in the index above. As Archaea are living organisms, then they must possess these properties as well. What are Archaea. We have learned that Biology can be illustrated as a tree of life:. In this tree of life, one of the basal branches evolves into a group of organisms that is part of Domain Prokarya, and is the current extant Kingdom Archaea. Archaebacteria is a synonym used by some authors for the kingdom of the archaea. Number of Kingdoms 2 3 5 6 8 Plantae Monera Monera Bacteria Bacteria Plantae Monera Monera Archaea Archaea. Prior to 1977 the archaea were considered to be just another group of bacteria, so archaea were first part of Kingdom Plantae green when there were only two kingdoms. archaea followed the bacteria as fellow prokary...
http://plantphys.info/organismal/lechtml/archaea.shtml
*  Wiley: Extremophiles: Sustainable Resources and Biotechnological Implications - Om V. Singh
United States Change My Account Cart Home Subjects About Wiley Contact Us Help Search Form Search Input Print this page Share Home / Life Sciences / Microbiology & Virology / Applied Microbiology Extremophiles: Sustainable Resources and Biotechnological Implications Om V. Singh ISBN: 978-1-118-10300-5 456 pages November 2012, Wiley-Blackwell Read an Excerpt Chapter (PDF) Index (PDF) Table of Contents (PDF) Description Explores the utility and potential of extremophiles in sustainability and biotechnology Many extremophilic bio-products are already used as life-saving drugs. Until recently, however, the difficulty of working with these microbes has discouraged efforts to develop extremophilic microbes as potential drug reservoirs of the future. Recent technological advances have opened the door to exploring these organisms anew as sources of products that might prove useful in clinical and environmental biotechnology and drug development. Extremophiles features outstanding articles by expert scientists who she...
http://wiley.com/WileyCDA/WileyTitle/productCd-1118103009.html
*  Frontiers | Global Biodiversity of Aquatic Ammonia-Oxidizing Archaea is Partitioned by Habitat | Aqu
Global Biodiversity of Aquatic Ammonia-Oxidizing Archaea is Partitioned by Habitat. We will be provided with an authorization token please note: passwords are not shared with us and will sync your accounts for you. This means that you will not need to remember your user name and password in the future and you will be able to login with the account you choose to sync, with the click of a button. Original Research ARTICLE. Global biodiversity of aquatic ammonia-oxidizing archaea is partitioned by habitat Steven J. Biller 1 †, Annika C. Francis 1 * 1 Department of Environmental Earth System Science, Stanford University, Stanford, CA, USA. 2 Department of Civil and Environmental Engineering, Stanford University, Stanford, CA, USA. Since the initial discovery of an ammonia monooxygenase α-subunit amoA gene associated with an archaeal metagenomic fragment, archaeal amoA sequences have been detected in a wide variety of nitrifying environments. Recent sequencing efforts have revealed extensive divers...
http://journal.frontiersin.org/article/10.3389/fmicb.2012.00252/abstract
*  Extremophiles stories at Techdirt.
... Filed Under: biology, blackfish, extremophiles, food chain, life, nature, sharks, volcanoes. DailyDirt: Joe Life Versus The Volcano from the urls-we-dig-up dept. 1 Comments. Read More. from the urls-we-dig-up dept. If you'd like to read more awesome and interesting stuff, check out this unrelated but not entirely random. Techdirt post via StumbleUpon. 15 Comments. Read More. Filed Under: bacteria, biofuel, biotech, carbon dioxide, electricity, energy, ethanol, extremophiles, fuel, hydrocarbons, petroleum, propane. DailyDirt: Storing Energy In Organic Molecules from the urls-we-dig-up dept. If you'd like to read more awesome and interesting stuff, check out this unrelated but not entirely random. Techdirt post via StumbleUpon. 9 Comments. Read More. Filed Under: astrobiology, et, extremophiles, insects, iss, lithopanspermia, microbes, panspermia, plankton, space. DailyDirt: All Kinds Of Bugs Living In Outer Space. from the urls-we-dig-up dept. The International Space Station ISS may have microorganisms li...
https://techdirt.com/blog/?tag=extremophiles
*  Danish Archaea Centre – University of Copenhagen
Danish Archaea Centre University of Copenhagen. Søg / Search. Global navigation Study at UCPH. Collaboration. PhD Programmes. Collaboration. Contact. Dansk. Danish Archaea Centre University of Copenhagen. Global navigation. Oversigt / Site navigation. Søg / Search. Ekstra information / Sidebar. Kolofon / Footer. DAC. Archaea and the third domain of Life The biology of organisms that grow optimally under extreme conditions has been of considerable interest in recent years and especially of those organisms thriving at extremes of temperature, pH or high salt concentrations. Most of these organisms are Archaea not Bacteria or Eukarya. The Danish Archaea Centre DAC has a long term basic research program focused on understanding the basic molecular and cellular biology of Archaea and in characterising their archaea-specific and many proto-eukaryotic cellular mechanisms and processes. We have been working with members of the crenarchaeal hyperthermophilic Order of Sulfolobales as model organisms and with the euryar...
http://dac.bio.ku.dk/
*  Archaea - Wikipedia, the free encyclopedia
Archaeal cells have unique properties separating them from the other two domains of life, Bacteria and Eukaryota. Other aspects of archaeal biochemistry are unique, such as their reliance on ether lipids in their cell membranes. Salt-tolerant archaea the Haloarchaea use sunlight as an energy source, and other species of archaea fix carbon ; however, unlike plants and cyanobacteria, no known species of archaea does both. Archaea are a major part of Earth's life and may play roles in both the carbon cycle and the nitrogen cycle. 2 Origin and evolution 2.1 Comparison to other domains 2.2 Relationship to other prokaryotes 2.3 Relation to eukaryotes. Woese argued that this group of prokaryotes is a fundamentally different sort of life. Current knowledge on genetic diversity is fragmentary and the total number of archaeal species cannot be estimated with any accuracy. One of the interesting results of his experiments was that the Archaea were more similar to eukaryotes than prokaryotes, even though they were more s...
https://en.wikipedia.org/wiki/Archea
*  Newest 'extremophiles' Questions - Biology Stack Exchange
Newest 'extremophiles' Questions - Biology Stack Exchange. Biology Meta. more stack exchange communities. Stack Exchange. Help Center Detailed answers to any questions you might have. Biology Questions. Tagged Questions info newest frequent votes active unanswered. 2 answers. 70 views. evolution genetics molecular-biology molecular-evolution extremophiles asked Mar 13 at 19:53. 0 answers. 148 views. We don't to know much about organisms living deep below the Earth's crust. life extremophiles asked Feb 17 at 0:55. 62 views. Beside many anaerobic single cell organisms, there are some annelid worms that are obligate anaerobic at least in their early development stages. extremophiles anaerobic-respiration asked May 21 '14 at 22:28. 175 views. plant-physiology photosynthesis extremophiles asked May 5 '14 at 3:18. 3 answers. 173 views. Is it possible to have life in vacuum. physiology speculative extremophiles asked Apr 13 '14 at 9:01. 0 answers. 76 views. I have heard of 'extremophiles', lifeforms that nat...
http://biology.stackexchange.com/questions/tagged/extremophiles
*  Extremophiles
... photography from the arctic antarctic and the driest place on earth wade h jeffrey professor center for environmental diagnostics and bioremediation wuwf gallery the university of west florida january february closing reception february pm sun salt sand and ice reveal three environments threatened by climate change and commercial competition for natural resources university of west florida professor wade jeffrey studies how microbes respond to ultraviolet radiation ozone depletion and climate change photographs taken during depict the beauty of these luminous yet fragile landscapes home environments gallery biography contact acknowledgments prints...
http://uwf.edu/wjeffrey/extremophiles.html
*  Domain (biology)
Three-domain system. According to the Woese system, introduced in 1990, the tree of life consists of three domains: Archaea a term which Woese created, Bacteria, and Eukaryota. All life that has a nucleus and membrane-bound organelles, and most multi-cellular life, is included in the Eukaryota. Characteristics of the three domains of life Archaea. Exclusion of viruses Alternative classifications See also References External Links. Characteristics of the three domains of life. Image:Eocyte hypothesis.png|350px Image:Collapsed tree labels simplified.png Each of these three domains of life recognized by biologists today contain rRNA which is unique to them, and this fact in itself forms the basis of three-domain system. While the presence of nuclear membrane differentiates the Eukarya domain from Archaea domain and Bacteria domain - both of which lack nuclear membrane, the distinct biochemistry and RNA markers differentiate Archaea and Bacteria domains from each other. Archaea. Archaea are prokaryotic cell s whi...
https://en.wikipedia.org/wiki/Domain_(biology)
*  proteins - What's the opposite of a thermophile? - Biology Stack Exchange
proteins - What's the opposite of a thermophile. - Biology Stack Exchange. chat blog. Biology. Biology Meta. more stack exchange communities. Stack Exchange. sign up log in tour. help. Help Center Detailed answers to any questions you might have. Biology Questions. Unanswered. Ask Question. Sign up. Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. What's the opposite of a thermophile. up vote 5 down vote favorite. One of the signatures of thermophiles is that their proteins resist heat denaturation up to much higher temperatures than their mesophilic middle-loving homologs. Is there a corresponding group of extremophiles whose proteins resist cold denaturation down to much lower temperature than their mesophilic homologs. Or at least give me the proper name for this group of cold-loving extremophiles. proteins taxonomy extremophiles share. asked Apr 23 '12 at 19:09. there are organisms that survive in cold temperatures - like arctic plankton and fi...
http://biology.stackexchange.com/questions/1940/whats-the-opposite-of-a-thermophile
*  Neomura
1 unranked divisio = Clade Posibacteria phylum unranked classis = Clade Actinobacteria subphylum unranked subclassis = Clade Proteates unranked infraclassis = Clade 'Neomura' subdivision ranks = Domains and phylum subdivision = Phylum Archaebacteria. 'Neomura' is a clade composed of the two domains of life of Archaea and Eukaryota. Thomas Cavalier-Smith states, "Eukaryotes and archaebacteria form the clade neomura and are sisters, as shown decisively by genes fragmented only in archaebacteria and by many sequence trees. 1={{clade |1= Chlorobacteria |2={{Clade |1= Hadobacteria |2={{Clade |1= Cyanobacteria |2={{Clade |1= Gracilicutes |2={{Clade |1= Eurybacteria |2={{Clade |1= Endobacteria |2={{Clade |1= Actinobacteria |label2= Neomura |2=Clade |1= Archaea |2= Eukarya }} }} }}. Morphology History See also References Further reading. Image:A phylogenetic tree, showing how Eukaryota and Archaea are more closely related to each other than to Bacteria, based on Cavalier-Smith 's theory of bacterial evolution. When C...
https://en.wikipedia.org/wiki/Neomura
*  proteins - What's the opposite of a thermophile? - Biology Stack Exchange
proteins - What's the opposite of a thermophile. - Biology Stack Exchange. current community. chat blog. Biology. . Biology Meta. your communities. Sign up or log in to customize your list. more stack exchange communities. Stack Exchange. Inbox. Reputation and Badges. sign up log in tour. help. Tour Start here for a quick overview of the site. Help Center Detailed answers to any questions you might have. Meta Discuss the workings and policies of this site. Biology Questions. Tags. Users. Badges. Unanswered. Ask Question. Sign up. Biology Stack Exchange is a question and answer site for biology researchers, academics, and students. It's 100% free, no registration required. What's the opposite of a thermophile. up vote 5 down vote favorite. Thermophiles, heat-loving organisms, have been a popular topic of research for decades due in large part to the utility of their enzymes in various chemical reactions Taq Pol single-enzymedly made PCR practical. One of the signatures of thermophiles is that their...
http://biology.stackexchange.com/questions/1940/whats-the-opposite-of-a-thermophile?answertab=votes
*  Breakthroughs Magazine - Deconstructing Slime
breakthroughs magazine deconstructing slime in this issue past issues restore default deconstructing slime download pdf for years jill banfield has collected and studied the microbes that slime the floors of mines and convert iron to acid a common source of stream pollution around the world imagine her surprise then when research scientist brett baker discovered three new microbes living amidst the bacteria she thought she knew well smaller than any other known cellular life form we were essentially looking for new stuff says baker and we found it banfield a professor of environmental science policy and management and of earth and planetary science has been trying to understand how such extremophiles microbes that live in extreme environments live together and generate the acid drainage that makes such mines toxic hazards the collaborators have been using advanced genetic sequencing techniques to identify newly discovered microbes both bacteria and a type of organism known as archaea when baker turned up the ...
http://nature.berkeley.edu/breakthroughs/archives/break_briefs.php?title=Deconstructing Slime
*  Extremozyme
... an extremozyme is an enzyme often created by extremophiles that can function under extreme environmental conditions such as very high ph very low ph high temperature high salinity or other factors that would otherwise denature typical enzymes e g catalase rubisco carbonic anhydrase this feature makes these enzymes of interest to a variety of biotechnical applications see also extremophile berkeley pit enzyme polypeptide protein allostery references category proteins category extremophiles...
https://en.wikipedia.org/wiki/Extremozyme
*  Isolation of thermophiles
http://bio.net/bionet/mm/microbio/1997-November/010803.html
*  Archaeal proteins
... redirect archaea...
https://en.wikipedia.org/wiki/Archaeal_proteins
*  SMART: Secondary literature for SNc domain
... Secondary literature sources for SNc. Koonin EV, Mushegian AR, Galperin MY, Walker DR Comparison of archaeal and bacterial genomes: computer analysis of proteinsequences predicts novel functions and suggests a chimeric origin for thearchaea. 1997; 25 : 619-37 Display abstract Protein sequences encoded in three complete bacterial genomes, those ofHaemophilus influenzae, Mycoplasma genitalium and Synechocystis sp., andthe first available archaeal genome sequence, that of Methanococcusjannaschii, were analysed using the BLAST2 algorithm and methods for aminoacid motif detection. Between 75% and 90% of the predicted proteinsencoded in each of the bacterial genomes and 73% of the M. jannaschiiproteins showed significant sequence similarity to proteins from otherspecies. The fraction of bacterial and archaeal proteins containingregions conserved over long phylogenetic distances is nearly the same andclose to 70%. Functions of 70-85% of the bacterial proteins and about 70%of the archaeal proteins were predicted...
http://smart.embl-heidelberg.de/smart/show_secondary.cgi?domain=SNc
*  NIF | Searching in Literature
NIF LinkOut Portal. Leaving Community. Prediction of signal peptides in archaea. Computational prediction of signal peptides SPs and their cleavage sites is of great importance in computational biology; however, currently there is no available method capable of predicting reliably the SPs of archaea, due to the limited amount of experimentally verified proteins with SPs. We performed an extensive literature search in order to identify archaeal proteins having experimentally verified SP and managed to find 69 such proteins, the largest number ever reported. A detailed analysis of these sequences revealed some unique features of the SPs of archaea, such as the unique amino acid composition of the hydrophobic region with a higher than expected occurrence of isoleucine, and a cleavage site resembling more the sequences of gram-positives with almost equal amounts of alanine and valine at the position-3 before the cleavage site and a dominant alanine at position-1, followed in abundance by serine and glycine. Using...
https://scicrunch.org/18988691/resource/nlx_144509
*  Magic Lantern K10D Guide: Pentax SLR Talk Forum: Digital Photography Review
... Log in / Register. News. Reviews. Features. Buying Guide. Sample Images. Videos. Cameras. Lenses. Phones. Printers. Forums. Galleries. Challenges. Forum index. Pentax SLR Talk Change forum Magic Lantern K10D Guide Started Jun 15, 2007. Discussions thread. Shop cameras lenses ▾. Forum Parent First Previous Next Next unread. Flat view. Ned-B. Senior Member. Posts: 1,476. Gear list. Like. Magic Lantern K10D Guide Jun 15, 2007. In case anyone is interested, Magic Lantern has released their guide on the K10D... http://nedbunnell.blogspot.com/2007/06/magic-lantern-k10d-guide.html Cheers,. Ned. Ned-B's gear list: Ned-B's gear list Ricoh GR. Pentax K-3. Reply to thread Reply with quote. Complain. Forum Parent First Previous Next Next unread. Flat view. Post hide subjects. Posted by When Magic Lantern K10D Guide New. Ned-B. Jun 15, 2007. Re: Magic Lantern K10D Guide New. Jan Moren. Jun 15, 2007. Re: Magic Lantern K10D Guide New. Ishpuini. Jun 15, 2007. Re: Magic Lantern K10D Guide New. Ned-B. Jun 15, 2007....
http://dpreview.com/forums/post/23641241
*  Here is a Canon 6D Guide for Landscapes. :): Canon EOS-1D / 5D / 6D Talk Forum: Digital Photography
Here is a Canon 6D Guide for Landscapes. : : Canon EOS-1D / 5D / 6D Talk Forum: Digital Photography Review. Reviews. Buying Guide. Sample Images. Videos. Cameras. Lenses. Forums. Challenges. Forum index. Canon EOS-1D / 5D / 6D Talk Change forum Here is a Canon 6D Guide for Landscapes. : Started Apr 17, 2014. Shop cameras lenses ▾. Forum Parent First Previous Next Next unread. JoEick. Here is a Canon 6D Guide for Landscapes. : Apr 17, 2014. I wrote a guide to using the Canon 6D, with an emphasis on landscape photography. I have some dynamic range tests which may be of some interest. Canon 6D Guide Webpage. Let me know if you have any questions or feedback. Canon EOS 6D If you believe there are incorrect tags, please send us this post using our feedback form. Reply to thread Reply with quote. Forum Parent First Previous Next Next unread. Posted by When Here is a Canon 6D Guide for Landscapes. JoEick. Apr 17, 2014 23. Re: Here is a Canon 6D Guide for Landscapes. Apr 17, 2014. Re: Here is a Canon 6D Guide ...
http://dpreview.com/forums/post/53515857
*  Thaumarchaeota - Wikipedia, the free encyclopedia
... Thaumarchaeota From Wikipedia, the free encyclopedia. Thaumarchaeota. Archaea. " Thaumarchaeota " Brochier-Armanet et al. Nitrososphaeria Stieglmeier et al. " Candidatus Caldiarchaeum " Nunoura et al. 2011 " Candidatus Caldiarchaeum subterraneum " Nunoura et al. " Candidatus Giganthauma " Muller et al. " Candidatus Nitrosotalea " Lehtovirta 2011 " Candidatus Nitrosotalea devanaterra " Lehtovirta 2011. Cenarchaeales Cavalier-Smith 2002 " Cenarchaeaceae " DeLong and Preston 1996 Cenarchaeum ♠ DeLong and Preston 1996 Cenarchaeum symbiosum ♠ DeLong and Preston 1996. Nitrososphaerales Michaela Stieglmeier et al. 2014 Nitrososphaeraceae Michaela Stieglmeier et al. 2014 Nitrososphaera Michaela Stieglmeier et al. 2013 " Candidatus Nitrososphaera gargensis " Hatzenpichler et al. 2008 Nitrososphaera viennensis Michaela Stieglmeier et al. " Candidatus Nitrosopumilales " Konneke et al. " Candidatus Nitrosopumilus " Konneke et al. 2012 " Candidatus Nitrosopumilus maritimus " Konneke et al. The Thaumarchaeota or Thaum...
https://en.wikipedia.org/wiki/Thaumarchaeota
*  Molecular signatures for the Crenarchaeota and the Thaumarchaeota - Springer
... Molecular signatures for the Crenarchaeota and the Thaumarchaeota. Affiliated with Department of Biochemistry and Biomedical Sciences, McMaster University. Affiliated with Department of Biochemistry and Biomedical Sciences, McMaster University. We report here detailed analyses of protein sequences from Crenarchaeota and Thaumarchaeota that have identified many conserved signature indels CSIs and signature proteins SPs i.e., proteins for which all significant blast hits are from these groups that are specific for these archaeal groups. Of the identified signatures 6 CSIs and 13 SPs are specific for the Crenarchaeota phylum; 6 CSIs and 250 SPs are uniquely found in various Thaumarchaeota viz. Although some of these molecular signatures suggest a distant shared ancestry between Thaumarchaeota and Crenarchaeota, our identification of large numbers of Thaumarchaeota-specific proteins and their deep branching between the Crenarchaeota and Euryarchaeota phyla in phylogenetic trees shows that they are distinct f...
http://link.springer.com/article/10.1007/s10482-010-9488-3
*  KEGG PATHWAY: csy00072
kegg pathway csy pathway csy entry csy pathway name synthesis and degradation of ketone bodies cenarchaeum symbiosum class metabolism lipid metabolism pathway map csy synthesis and degradation of ketone bodies organism cenarchaeum symbiosum gene censya hydroxy methylglutaryl coa synthase k hydroxymethylglutaryl coa synthase censya acetyl coa acetyltransferase k acetyl coa c acetyltransferase censya ketoacyl coa thiolase k acetyl coa c acetyltransferase compound c acetyl coa c acetoacetate c acetone c acetoacetyl coa c s hydroxy methylglutaryl coa c r hydroxybutanoate ko pathway ko all links pathway biosystems gene kegg genes all databases download rdf dbget integrated database retrieval system...
http://genome.jp/dbget-bin/www_bget?pathway csy00072
*  Nitrosopumilus
... maritimus is an extremely common archaeon living in seawater it is the first member of the group a crenarchaeota to be isolated in pure culture gene sequences suggest that the group a crenarchaeota are ubiquitous with the oligotrophic surface ocean and can be found in most non coastal marine waters around the planet it is one of the smallest living organism s at micrometers in diameter it lives by oxidizing ammonia to nitrite n maritimus is capable of oxidizing ammonia at levels as low as nanomolar near the limit to sustain its life http www physorg com news html planet s nitrogen cycle overturned by tiny ammonia eater of the seas hannah hickey originally based on a nature publication by willm martens habbena david stahl this organism was isolated from sediment in a tropical tank at the seattle aquarium by a group led by david stahl university of washington in taxonomy candidatus nitrosopumilus is a genus of the nitrosopumilaceae see the ncbi data extracted from the references further reading scientific ...
https://en.wikipedia.org/wiki/Nitrosopumilus
*  Pfam: Proteome: Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB
Pfam: Proteome: Haloferax volcanii strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2 NCBI tax. 1418 architectures. Proteome: Haloferax volcanii strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2 NCBI tax. This section gives details of the Pfam domains that are found on the completed proteome of Haloferax volcanii strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2. Number of sequences:. Number of domains:. This example describes an architecture with one Gla domain, followed by two consecutive EGF domains, and finally a single Trypsin domain. a link to the page in the Pfam site showing information about the sequence that the graphic describes. the UniProt description of the protein sequence. Finally, because some families can be found in a very large number of architectures, we load only the first fifty architectures by default. Loading domain graphics... This section shows the composition of this proteome, in...
http://pfam.xfam.org/proteome?taxId=309800
*  aglM - UDP-glucose 6-dehydrogenase AglM - Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 887
/p> p> a href="/manual/evidences">More… /a> /p>. /p> p> a href='../manual/annotation score' target=' top'>More... /p> p> a href='../manual/protein existence' target=' top'>More... /p> p> a href='../manual/function section' target=' top'>More... 75:1047-1058 2010 Cited for : NUCLEOTIDE SEQUENCE, FUNCTION, CATALYTIC ACTIVITY, ENZYME REGULATION, PATHWAY, GENE NAME. 75:1047-1058 2010 Cited for : NUCLEOTIDE SEQUENCE, FUNCTION, CATALYTIC ACTIVITY, ENZYME REGULATION, PATHWAY, GENE NAME. 75:1047-1058 2010 Cited for : NUCLEOTIDE SEQUENCE, FUNCTION, CATALYTIC ACTIVITY, ENZYME REGULATION, PATHWAY, GENE NAME. 75:1047-1058 2010 Cited for : NUCLEOTIDE SEQUENCE, FUNCTION, CATALYTIC ACTIVITY, ENZYME REGULATION, PATHWAY, GENE NAME. Proteins known to be involved in this subpathway in this organism are: UDP-glucose 6-dehydrogenase AglM aglM. 75:1047-1058 2010 Cited for : NUCLEOTIDE SEQUENCE, FUNCTION, CATALYTIC ACTIVITY, ENZYME REGULATION, PATHWAY, GENE NAME. p>UniProtKB Keywords constitute a a target=" t...
http://uniprot.org/uniprot/D4GYH5
*  KEGG T01200: HVO 2759
... Haloferax volcanii: HVO 2759. Entry HVO 2759 CDS T01200. Definition RefSeq TET aminopeptidase-like protein EC:3.2.1.4. endoglucanase. Organism hvo Haloferax volcanii. Pathway hvo00500. Starch and sucrose metabolism. hvo01100. Metabolic pathways. Brite KEGG Orthology KO Metabolism Carbohydrate metabolism 00500 Starch and sucrose metabolism HVO 2759 Enzymes 3. Hydrolases 3.2 Glycosylases 3.2.1 Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds 3.2.1.4 cellulase HVO 2759. Position complement 2597806..2598870. AA seq 354 aa. NT seq 1065 nt. +upstream nt +downstream nt atggacgacgaccgacgcgccttcctcgaagacctgctcaccacacccagtccgtccggc tacgaggtcgccggccagcgcgtgtgggtggactacgtctcgcagttcgccgacgacgtg acggtcgacgactacggcaacgccgtcgcggtccacgagggcaccggcgagggcccggaa atcgccttcaccggccacgcggaccaaatcggctacatcgtccgcgacatcgacgacgac ggcttcgtccgcatcggccccatcggcggcgcggaccgcaccgtctcgaagggccagcac gtgacggtccacggcgacgacggcgacgtggcgggcgtcatcggtcagaccgccatccac ctccgcgacgtgggcagcgaggagtacgacgacctcgaagagcagttcgtcgatatcggc gc...
http://genome.jp/dbget-bin/www_bget?hvo:HVO_2759
*  DSpace@MIT: Browsing Theses - Dept. of Biology by Title
... DSpace @ MIT. Browsing Theses - Dept. of Biology by Title. MIT Theses. → Theses - Dept. of Biology → Browsing Theses - Dept. of Biology by Title. Browsing Theses - Dept. of Biology by Title. Sort by: title submit date issue date Order: ascending descending Results: 5 10 20 40 60 80 100. Now showing items 783-794 of 794. Schafheimer, Nathaniel Steven Nathaniel Massachusetts Institute of Technology, 2013. Joseph Harry, III Massachusetts Institute of Technology, 2010. Armand John, 1963- Massachusetts Institute of Technology, 1999. Amsterdam, Adam Adam Henry, 1967- Massachusetts Institute of Technology, 1998. Use of bgaH as a reporter gene for studying translation initiation in the archaeon Haloferax volcanii . Massachusetts Institute of Technology Massachusetts Institute of Technology, 2008. To study the function of initiator tRNAs in translation initiation in Haloferax volcanii, the initiator AUG codon of the bgaH gene was mutated ... Using chemical biology as a tool to probe the mechanism of the HDL rece...
http://dspace.mit.edu/handle/1721.1/7589/browse?rpp=20&order=ASC&sort_by=1&etal=-1&type=title&starts_with=U
*  HVO opening brings new jobs to Haywood County
... Smoky Mountain News. HVO opening brings new jobs to Haywood County Written by Colby Dunn. With the snip of a ribbon last Friday, Haywood County gained a new manufacturing facility and the promise of 75 new jobs thanks to Haywood Vocational Opportunities, who christened their new Westwood facility. The 117,000-square-foot space was once home to Wellco Enterprises, but when the plant was shuttered in 2009, HVO snapped it up, renovating 70 percent of the space for use in its medical product manufacturing operation. Ray Rapp D-Mars Hill, Waynesville Mayor Gavin Brown, as well as other local officials, HVO employees and local residents who were taken on tours showcasing the new facility and various bells and whistles. The new plant will expand the operations that started in the company’s Riverbend Street building, providing more space for production and more job opportunities for local adults with disadvantages and disabilities, which is HVO’s mission. “This is going to allow us to diversify into higher tech ...
http://smokymountainnews.com/archives/item/2147-hvo-opening-brings-new-jobs-to-haywood-county
*  Archaeosortase
... an archaeosortase is a protein that occurs in the cell membrane s of some archaea archaeosortases recognize and remove carboxyl terminal protein sorting signals about amino acids long from secreted proteins a genome that encodes one archaeosortase may encode over fifty target proteins the best characterized archaeosortase target is the haloferax volcanii s layer glycoprotein an extensively modified protein with o linked glycosylations n linked glycosylations and a large prenyl derived lipid modification toward the c terminus it remains unclear if archaeosortase is a protease that simply removes the c terminal segment or a transpeptidase that attaches a lipid moiety in its place archaeosortases are related to exosortase s their counterparts in gram negative bacteria the names of both families of proteins reflect roles analogous to sortase s in gram positive bacteria with which they share no sequence homology the sequences of archaeosortases and exosortases consists mostly of hydrophobic transmembrane heli...
https://en.wikipedia.org/wiki/Archaeosortase
*  CH391L/S12/CH391L/S12/Ancestral Sequence Reconstruction - OpenWetWare
... CH391L/S12/CH391L/S12/Ancestral Sequence Reconstruction From OpenWetWare CH391L/S12 Revision as of 15:45, 13 February 2012 by Jared Ellefson Talk. 1 What is Ancestral Sequence Reconstruction. 1.1 Pipeline for Generating Ancestral Genes 1.1.1 Methods of Inferring Ancient Sequences 1.1.2 Gene Synthesis 1.1.3 Testing Ancestral Variants. 1.2 Examples of Ancestral Sequence Reconstructions 1.2.1 Evolution of Coral Pigments 1.2.2 Inferring the Paleoenvironment of ancient Earth. What is Ancestral Sequence Reconstruction. Sequence information Nucleic Acid and Protein from extant species can be used to infer the sequences of common ancestor species which can be synthesized and tested in the lab. Sequence Reconstruction Example. Sequences from extant species of the desired common ancestral gene and outgroup genes are aligned. The ancestral gene is inferred based on evolutionary models typically maximum parsimony or maximum likelihood. Ancestral genes are cloned and tested for function. Methods of Inferring Ancient ...
http://openwetware.org/index.php?title=CH391L/S12/CH391L/S12/Ancestral_Sequence_Reconstruction&oldid=583945
*  CH391L/S13/Ancestral Sequence Reconstruction - OpenWetWare
... Ancestral Sequence Reconstruction refers to the construction of hypothesized protein or DNA sequences belonging to a common ancestor of extant proteins or DNA. Sequence information Nucleic Acid and Protein from extant species can be used to infer the sequences of common ancestor species which can be synthesized and tested in the lab. The method was originally discussed by Pauling and Zuckerkandl in 1963 cite Pauling /cite, almost 30 years before the theory was experimentally tested. Ancestral Sequence Reconstruction refers to the construction of hypothesized protein or DNA sequences belonging to a common ancestor of extant proteins or DNA. Sequence information Nucleic Acid and Protein from extant species can be used to infer the sequences of common ancestor species which can be synthesized and tested in the lab. The method was originally discussed by Pauling and Zuckerkandl in 1963 cite Pauling /cite, almost 30 years before the theory was experimentally tested. ==Pipeline for Generating Ancestral Genes==...
http://openwetware.org/index.php?title=CH391L/S13/Ancestral_Sequence_Reconstruction&diff=677463&oldid=677462
*  CH391L/S13/Ancestral Sequence Reconstruction - OpenWetWare
... CH391L/S13/Ancestral Sequence Reconstruction From OpenWetWare Difference between revisions Jump to: navigation, search Revision as of 19:53, 24 February 2013 view source Aurko Dasgupta Talk. contribs → Evolution of Coral Pigments ← Previous diff. Revision as of 19:55, 24 February 2013 view source Aurko Dasgupta Talk. contribs → Evolution of Coral Pigments Next diff →. Line 30:. Line 30:. One example of ancestral sequence reconstruction was done by the Matz group currently residing at the University of Texas at Austin. Fluorescent proteins from related coral species had wavelengths corresponding to Cyan, Green, and Red cite #Ugalde /cite. The details of the evolution of fluorescent color in the GFP superfamily was not fully understand. That is, what fluorescent spectra did the common ancestors of the modern corals have. One example of ancestral sequence reconstruction was done by the Matz group currently residing at the University of Texas at Austin. Fluorescent proteins from related coral species had wav...
http://openwetware.org/index.php?title=CH391L/S13/Ancestral_Sequence_Reconstruction&diff=678933&oldid=678932
*  Branching order of bacterial phyla (Gupta, 2001)
branching order of bacterial phyla gupta branching order of bacterial phyla gupta bacterial phyla there are several models of the branching order of bacterial phyla one of these was proposed in by gupta based on conserved indels or protein termed protein signatures an alternative approach to molecular phylogeny some problematic exceptions and conflicts are present to these conserved indels however they are in agreement with several groupings of classes and phyla one feature of the cladogram obtained with this method is the clustering of cell wall morphology with some exceptions from monoderms to transitional diderms to traditional diderms in the cladogram below yellow pseudopeptidoglycan monoderms gram variable red thick peptidoglycan monoderms gram positive blue thin peptidoglycan diderms gram negative green atypical see note in parethesis cladex style width auto bar gold archaea cladex bar crimson firmicutes cladex bar crimson actinobacteria see also branching order of bacterial phyla woese branching order ...
https://en.wikipedia.org/wiki/Branching_order_of_bacterial_phyla_(Gupta,_2001)
*  CH391L/S13/Ancestral Sequence Reconstruction - OpenWetWare
Fluorescent proteins from related coral species had wavelengths corresponding to Cyan, Green, and Red. That is, what fluorescent spectra did the common ancestors of the modern corals have. Sequences for the common ancestor nodes were synthesized and tested for their activity. The common ancestor to all the superfamily had a green emission peak. The more recent common ancestor of Green/Red had two emission peaks; a strong green peak and a smaller red peak. Fluorescent proteins from related coral species had wavelengths corresponding to Cyan, Green, and Red. That is, what fluorescent spectra did the common ancestors of the modern corals have. Sequences for the common ancestor nodes were synthesized and tested for their activity. The common ancestor to all the superfamily had a green emission peak. The more recent common ancestor of Green/Red had two emission peaks; a strong green peak and a smaller red peak. 1.2 Examples of Ancestral Sequence Reconstructions 1.2.1 Evolution of Coral Pigments 1.2.2 Inferring the...
http://openwetware.org/index.php?title=CH391L/S13/Ancestral_Sequence_Reconstruction&diff=678913&oldid=678912
*  The FASTML Server - Server for computing Maximum Likelihood ancestral sequence reconstruction
the fastml server server for computing maximum likelihood ancestral sequence reconstruction home overview gallery source code citing credits old version the fastml server server for computing maximum likelihood ancestral sequence reconstruction type your multiple sequence alignment msa fasta format only or upload your multiple sequence alignment msa file sequences type amino acids nucleotides codons type your phylogenetic tree optional newick format only or upload phylogenetic tree file newick format only model of substitution jtt default lg mtrev for mitochondrial proteins cprev for chloroplasts proteins wag dayhoff jc model jukes and cantor t model tamura hky model hasegawa kishino and yano gtr generalised time reversible yang for codon sequences empiricodon for codon sequences please enter your email address optional your email address will be used to update you the moment the results are ready load an example advanced options phylogenetic tree method maximum likelihood ml neighbor joining optimize branch ...
http://fastml.tau.ac.il/
*  Comparison of Protein Sequences: BLAST searching and Phylogenetic Tree Construction
... Inquiry-based Integrated Instructional Units Comparison of Protein Sequences: BLAST searching and Phylogenetic Tree Construction. It accompanies several weeks of wet lab work in which students clone cDNAs encoding Cytochrome P450 1A CYP1A from animals primarily fish collected locally and exposed to pollution compounds that induce expression of the enzyme. In this exercise, students perform BLAST searches of reported CYP1A sequences and construct phylogenetic trees using CYP1A amino acid sequences from various vertebrate species, especially those with multiple CYP1A paralogs. Thus, evolutionary analysis of CYP1A sequences from many species provides an opportunity to explore the number and timing of gene duplications during vertebrate evolution. Three short readings about gene duplication in evolution and phylogenetic analysis are provided at least one week prior to class. These readings complement earlier readings that specifically concern the cloning and evolutionary analysis of CYP1A genes in fish. Mate...
http://serc.carleton.edu/genomics/units/19100.html
*  Talk:CH391L/S13/Ancestral Sequence Reconstruction - OpenWetWare
... Talk:CH391L/S13/Ancestral Sequence Reconstruction. From OpenWetWare. Talk:CH391L/S13 Revision as of 00:02, 24 February 2013 by Aurko Dasgupta Talk. contribs. diff ←Older revision. Current revision diff. Newer revision→ diff. Jump to: navigation, search. Gabriel Wu 16:59, 18 February 2013 EST : Remove the cost and methods of gene synthesis or just reference the dna assembly section we've already gone over. Expand the codon optimization section unless this fits better in somewhere else. Gabriel Wu 16:59, 18 February 2013 EST : How does Pauling's proposal for ancestral gene construction relate to the actual discovery of DNA structure. Benjamin Gilman 13:21, 21 February 2013 EST : The Pauling and Zuckerkandl paper came out when the only protein sequence information we had came from limited peptide sequencing methods like Edman degradation N-terminal sequencing. You might add something about the shift to using DNA or RNA sequences to infer protein sequence once techniques like Maxam-Gilbert and Sanger sequenc...
http://openwetware.org/index.php?title=Talk:CH391L/S13/Ancestral_Sequence_Reconstruction&direction=prev&oldid=678776
*  Ancestral reconstruction
'Ancestral Reconstruction' also known as 'Character Mapping' or 'Character Optimization' is a method in evolutionary biology by which one can attempt to understand the phenotypic and genetic states of organisms that lived millions of years ago. Maximum Parsimony. Maximum likelihood. They are: maximum parsimony, maximum likelihood, and the Bayesian Inference. Maximum parsimony is the method that came about first. Maximum likelihood accounts for what we know about the likelihood of various events, which is that they are not all equal. Maximum Parsimony. Maximum Parsimony. Maximum likelihood. The main difference between this and maximum parsimony is that the maximum likelihood test accounts for the fact that not all events are equally likely to happen. When this is the case, maximum parsimony may actually be more accurate because it is more willing to make large, unlikely leaps than maximum likelihood is. Maximum likelihood has been shown to be quite reliable in reconstructing character states however it does no...
https://en.wikipedia.org/wiki/Ancestral_reconstruction
*  Viral phylodynamics
... Due to the impact that transmission dynamics and selection can have on viral genetic variation, viral phylogenies can therefore be used to investigate important epidemiological, immunological, and evolutionary processes, such as epidemic spread,. Methods Coalescent theory and phylodynamics. Examples Phylodynamics of Influenza. Phylodynamics of HIV. The clustering of taxa on a viral phylogeny will be affected by host population structure see figure 2 Viruses within similar hosts, such as hosts that reside in the same geographic region, are expected to be more closely related genetically if transmission occurs more commonly between them. For example, an application to HIV sequences within infected hosts showed that viral substitution rates dropped to effectively zero following the initiation of antiretroviral drug therapy. If the population size N t changes over time, the coalescent rate \lambda n t will also be a function of time. derived this rate for a time-varying population size under the assumption o...
https://en.wikipedia.org/wiki/Viral_phylodynamics
*  Diagnostic characters from Consortium of mx users. - Encyclopedia of Life
... Diagnostic characters. 2011, by Lewis L. Deitz and Matthew S. Wallace. Add to a collection. Diagnostic characters. Distance from eye to base of forewing usually greater than half eye width exceptions: Deiroderes and many Nicomiinae. Pronotum usually produced posteriorly over scutellum exceptions: Endoiastinae, Nicomiinae, Deiroderes, Abelus, and Hemicentrus, often also with anterior, lateral, or dorsal projections. Forewings with vein M fused with Cu basally share common stem; exceptions: some Nicomia and some Smiliinae. Prothoracic trochanter and femur not fused. Male abdominal segment IX usually with lateral plates discrete from pygofer exceptions: fused to pygofer in few members of various tribes; lateral plates absent in Anchistrotus and some Stegaspidini. Female pygofer not strongly produced posteroventrally. Nymph with abdominal tergum IX forming sheath around segment X, anal opening dorsal or posterior. Latest updates. No one has provided updates yet. Learn how to contribute. Add a new comment. Yo...
http://eol.org/data_objects/12685167
*  Browse By Person: Phillips, Matthew | QUT ePrints
Browse By Person: Phillips, Matthew. Browse By Person: Phillips, Matthew Statistics dashboard. Review. Book Chapter Phillips, Matthew J. Penny, David 2010 Mammalian phylogeny., Phillips, Matthew J. PLoS ONE, 10 5, e0125723., Carrano, Matthew T. Systematic Biology. Phillips, Matthew J., Gibb, Gillian C. 2014 Molecular phylogeny, biogeography, and habitat preference evolution of marsupials. Molecular Biology and Evolution, 31 9, pp., Phillips, Matthew J. Phillips, Matthew J., Gibb, Gillian,. Bunce, Michael 2013 Inferring kangaroo phylogeny from incongruent nuclear and mitochondrial genes. PLoS ONE, 8 2, pp. Phillips, Matthew J. Current Biology, 23 14, R603-R605., Phillips, Matthew J. Molecular Phylogenetics and Evolution, 59 3, pp., Phillips, Matthew J. 2010 Evolutionary relationships and divergence times among the native rats of Australia. 2009 The evolutionary history of the extinct ratite moa and New Zealand Neogene paleogeography. 2009 Accounting for calibration uncertainty in phylogenetic estimation of evo...
http://eprints.qut.edu.au/view/person/Phillips,_Matthew.html
*  Wiegmann Lab: Current Research
Insect Molecular Systematics at NCSU. phylogenetic relationships and testing hypotheses about the evolution and diversification of insects. A major component of these studies is uncovering patterns and processes of DNA sequence evolution and using these to improve interpretation of morphological and developmental evolutionary pathways. Molecular Phylogenetics of Diptera: FLYTREE - NSF - Assembling the Tree of Life project on Diptera a Collaborative Research Effort in Dipteran Phylogenetics. The need for new, large, comprehensive datasets for Diptera phylogeny motivates our collaborative, National Science Foundation funded, Assembling the Tree of Life ATOL project-- FLYTREE. Within this study, we are assembling multiple phylogenetic data sets to simultaneously assess dipteran phylogenetic relationships and the information content of specific character systems. For example, we will compare large by character data sets 1st tier; 45 taxa; 15-20 genes and mt genomes to those with increased numbers of taxa by taxa ...
http://www4.ncsu.edu/unity/users/b/bwiegman/public_html/labweb/currentresearch.html
*  Talk:CH391L/S13/DirectedProteinEvolution - OpenWetWare
Gabriel Wu Talk. *' ] 21:45, 21 February 2013 EST ':It would be nice if you added literature examples of Directed Evolution of Proteins for each approach as done in the Ancestral Sequence Reconstruction or take a similar approach. *' ] 21:45, 21 February 2013 EST ':It would be nice if you added literature examples of Directed Evolution of Proteins for each approach as done in the Ancestral Sequence Reconstruction or take a similar approach. + *' ] 15:33, 2 March 2013 EST ':It would be nice to put some numbers on the typical plasmid screening in 'E. + ****' ] 14:03, 4 March 2013 EST ': This is an interesting point. *' ] 04:13, 27 February 2013 EST ':I thought it'd be nice to have a section explaining fitness landscapes and moving through sequence space. *' ] 04:13, 27 February 2013 EST ':I thought it'd be nice to have a section explaining fitness landscapes and moving through sequence space. It's true that many times the selection will result in being trapped in a local optima, but other times the selection wi...
http://openwetware.org/index.php?title=Talk:CH391L/S13/DirectedProteinEvolution&diff=680636&oldid=680003
*  Systematics
thumb|400px|A comparison of phylogenetic and phenetic concepts Biological '''systematics''' is the study of the diversification of living forms, both past and present, and the relationships among living things through time. Phylogenetic trees of species and higher taxa are used to study the evolution of traits e.g., anatomical or molecular characteristics and the distribution of organisms biogeography. Systematics, in other words, is used to understand the evolutionary history of life on Earth. Definition and relation with taxonomy Taxonomic characters See also References Notes. Definition and relation with taxonomy. Europeans tend to use the terms "systematics" and "biosystematics" for the field of the study of biodiversity as a whole, whereas North Americans tend to use "taxonomy" more frequently. Taxonomic characters. Molecular characters. Immunological distance Electrophoretic differences Amino acid sequences of proteins DNA hybridization DNA and RNA sequences Restriction endonuclease analyses Other molec...
https://en.wikipedia.org/wiki/Systematics
*  Difference between revisions of "Molecular Systematics Spring 2014" - EEBedia
Difference between revisions of "Molecular Systematics Spring 2014" From EEBedia. Chris Simon. Chris Simon. :{{pdf|http://hydrodictyon.eeb.uconn.edu/courses/molsyst-eeb5350/Lab%208.%20Kasey%20Pregler%20MiniPresentation%2012April12.pdf}}EEB 5350 Lab 8. Kasey Pregler MiniPresentation 12April12.pdf. :{{pdf|http://hydrodictyon.eeb.uconn.edu/courses/molsyst-eeb5350/Lab%208.%20Kasey%20Pregler%20MiniPresentation%2012April12.pdf}}EEB 5350 Lab 8. Kasey Pregler MiniPresentation 12April12.pdf. Instructor: Chris Simon, Biopharm 305D, 6-4640, chris.simon@uconn.edu Graduate Assistant: Chris Owen, Biopharm 325A, christopher.l.owen@uconn.edu ; 6-3947. Readings: will be posted as PDF’s. Lectures will examine some of the most serious problems in evolutionary tree construction: nucleotide bias, alignment, homoplasy, among-site rate variation, taxon sampling, long branches, big trees, heterogeneous rates of evolution among branches, covarion shifts. Syllabus Molecular Systematics rev 28 Mar 12.pdf Assignment 1. How molecules evo...
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Molecular_Systematics_Spring_2012&diff=21831&oldid=21782
*  Molecular phylogenetics
'Molecular phylogenetics ' is the branch of phylogeny that analyses hereditary molecular differences, mainly in DNA sequences, to gain information on an organism's evolutionary relationships. History of molecular phylogenetics Techniques and applications Theoretical background Limitations of molecular systematics See also Notes and references Further reading External links. A comprehensive step-by-step protocol on constructing phylogenetic tree, including DNA/Amino Acid contiguous sequence assembly, multiple sequence alignment, model-test testing best-fitting substitution models and phylogeny reconstruction using Maximum Likelihood and Bayesian Inference, is available at Nature Protocol Bast, F. These have been replaced in recent times largely by DNA sequencing, which produces the exact sequences of nucleotides or 'bases' in either DNA or RNA segments extracted using different techniques. In a molecular systematic analysis, the haplotypes are determined for a defined area of genetic material ; a substantial s...
https://en.wikipedia.org/wiki/Molecular_phylogenetics
*  CH391L/S13/DNA Computing - OpenWetWare
... CH391L/S13/DNA Computing From OpenWetWare Difference between revisions Jump to: navigation, search Revision as of 11:55, 1 April 2013 view source Dwight Tyler Fields Talk. contribs m New page: Hello world. ← Previous diff. Revision as of 12:03, 1 April 2013 view source Dwight Tyler Fields Talk. contribs m Next diff →. Line 1:. Line 1:. - Hello world. + ] ]. + =Introduction=. + Ancestral Sequence Reconstruction refers to the construction of hypothesized protein or DNA sequences belonging to a common ancestor of extant proteins or DNA. It enables scientists to synthesize biomolecules from extinct organisms. Sequence information Nucleic Acid and Protein from extant species can be used to infer the sequences of common ancestor species which can be synthesized and tested in the lab. The method was originally discussed by Pauling and Zuckerkandl in 1963 cite Pauling /cite, almost 30 years before the theory was experimentally tested. + ]. + + ==Pipeline for Generating Ancestral Genes==. + # Sequences from extan...
http://openwetware.org/index.php?title=CH391L/S13/DNA_Computing&diff=687401&oldid=687389
*  Phylogenetic Classification ( Real World ) | Biology | CK-12 Foundation
Phylogenetic Classification Real World. Help. Help. You are viewing an older version of this Concept. Go to the latest version. Phylogenetic Classification. Practice Phylogenetic Classification Practice. 0% Practice Now. Evolution. Resources. Published. Cows Gone Wild. The "cows" you see are Aurochs Bos primigenius. They are the species of bovine that humans domesticated to form our modern day cows. Looking at the cave paintings of aurochs, you may get the sense that they were a bit different than our domesticated cattle. The characteristics which made aurochs successful in the wild were not the characteristics that humans thought were most useful. For example, packing on lots of meat may be a great trait in a cow for a cattle rancher, but if that meat hampers mobility, then it can make a cow an easy target to predators. This is one of the differences between artificial selection and natural selection. However, it does not take 600 years for noticeable changes to appear in bred species once the artificial sel...
http://ck12.org/biology/Phylogenetic-Classification/rwa/21st-Century-Auroch/r8/
*  Filosofía, especie y sistemática
Host structure of the Phylogeny of West Nile Virus WNV: Does it shape the spatiotemporal structure. Methods Sequence Data: All the available sequences of complete genome of WNV, with collection times, and geographic locations 453 sequences, from 25 countries, and 79 hosts species were retrieved from GenBank. Phylogeny inferred using a Maximum likelihood analysis of 53 sequences. Phylogeny with Host structure for WNV. Just Testudines present a different resutl, where the non-nuclear and nuclear partitions had the lowest values Fig. Estimating Evolutionary Rates and Times to the last Common Ancestor DEV-2, using partitions vs complete coding region. Several studies have been aimed at understanding the epidemiology of DENV, rates and dates of evolution, and selection pressure in its different genes and genotypes Rico-hesse Rico-hesse, 1990; Rico-Hesse et al., 1997; S. The objectives of this study were to infer the time to the Most recent common ancestor MRCA of the DENV2 genotypes, and estimate the evolutionary ...
http://elecsist.blogspot.com/
*  PCA and clustering reveal alternate mtDNA phylogeny of N and M clades. | Broad Institute of MIT and
PCA and clustering reveal alternate mtDNA phylogeny of N and M clades. Broad Institute of MIT and Harvard. Partnerships Philanthropy Careers Contact Us. What is Broad. Our Approach Areas of Focus History Leadership Who is Broad Partner Institutions Artist-in-Residence Media Center. Press Room News from the Broad Photos for Journalists Spotlight: Ebola Spotlight: CRISPR BroadMinded Blog Video Library For the Scientific Community. Scientific Publications Science Data Software. Scientific Publications Science Data Software. Home. News & Publications:Scientific Publications PCA and clustering reveal alternate mtDNA phylogeny of N and M clades. Recent Broad Publications Inherited CHST11/MIR3922 deletion is associated with a novel recessive syndrome presenting with skeletal malformation and malignant lymphoproliferative disease. Read More / View Supplemental Materials Ferritinophagy via NCOA4 is required for erythropoiesis and is regulated by iron dependent HERC2-mediated proteolysis. Read More / View Supplemental ...
https://broadinstitute.org/publications/broad3822
*  Phylogenomics
It is a group of techniques within the larger fields of phylogenetics and genomics. Phylogenomics draws information by comparing entire genomes, or at least large portions of genomes. 1 Phylogenetics compares and analyzes the sequences of single genes, or a small number of genes, as well as many other types of data. Prediction of gene function Establishment and clarification of evolutionary relationships Gene family evolution Prediction and retracing lateral gene transfer. Prediction of Gene Function Prediction and Retracing Lateral Gene Transfer Gene family evolution Establishment of Evolutionary Relationships Databases See also References. Before the use of phylogenomic techniques, predicting gene function was done primarily by comparing the gene sequence with the sequences of genes with known functions. 3 This prediction was based on the fact that this organism has a gene for which the sequence is highly similar to genes from other species in the "MutS" gene family which included many known to be involved ...
https://en.wikipedia.org/wiki/Phylogenomics
*  Wikiomics:RNA phylogenetics - OpenWetWare
... Wikiomics:RNA phylogenetics From OpenWetWare Difference between revisions Jump to: navigation, search Revision as of 17:04, 3 March 2008 view source Torsten Waldminghaus Talk. contribs added tags ← Previous diff. Current revision 05:34, 20 October 2009 view source Albert Vilella Talk. contribs adding rnasalsa. One intermediate revision not shown. Line 16:. Line 16:. * Bayesian Inference of Phylogeny. Allows secondary structure models. * Bayesian Inference of Phylogeny. Allows secondary structure models. * Designed specifically for use with RNA sequences that have a conserved secondary structure, e.g., rRNA and tRNA. Substitution models of sequence evolution that consider pairs of sites rather than single sites are implemented in this package along with standard nucleotides substitution models used nowadays. When a RNA molecule with a secondary structure is used in conjunction with a RNA substitution model, PHASE requires a structure-based alignment of the sequences with the consensus secondary structure ...
http://openwetware.org/index.php?title=Wikiomics:RNA_phylogenetics&diff=360520&oldid=189099
*  Polyphyly
Image:Monophyly, paraphyly, polyphyly.png File:Phylogenetic-Groups.svg|thumbnail|300px|Phylogenetic groups: A monophyletic taxon in yellow, the group of "reptiles and birds" contains a common ancestor and all of its descendants. A paraphyletic taxon in cyan, the reptiles contains its most recent common ancestor, but does not contain all the descendants of that ancestor. A polyphyletic in red, the group of all warm-blooded animals taxon does not contain the most recent common ancestor of all its members. A 'polyphyletic' Greek for "of many races" group is characterized by one or more homoplasies : phenotype s which have converged or reverted so as to appear to be the same but which have not been inherited from common ancestors. For example, warm-bloodedness evolved separately in the ancestors of mammals and the ancestors of birds 1. Researchers concerned more with ecology than with systematics may take polyphyletic groups as legitimate subject matter; the similarities in activity within the fungus group ' Alte...
https://en.wikipedia.org/wiki/Polyphyly
*  Difference between revisions of "Molecular Systematics Spring 2014" - EEBedia
Chris Simon. Chris Simon. :{{pdf|http://hydrodictyon.eeb.uconn.edu/courses/molsyst-eeb5350/EEB%205350%20Lab%209.%20Minipresentation%20RT-PCR%20Brigette.pdf}}EEB 5350 Lab 9. Minipresentation RT-PCR Brigette.pdf. :{{pdf|http://hydrodictyon.eeb.uconn.edu/courses/molsyst-eeb5350/EEB%205350%20Lab%209.%20Minipresentation%20RT-PCR%20Brigette.pdf}}EEB 5350 Lab 9. Minipresentation RT-PCR Brigette.pdf. Combining Data/Comparing Trees. + + :{{pdf|http://hydrodictyon.eeb.uconn.edu/courses/molsyst-eeb5350/Comparing%20Trees%20Combining%20Data%20Readings%202012.pdf}}Comparing Trees Combining Data Readings 2012.pdf. + + Reading for next week: :{{pdf|http://hydrodictyon.eeb.uconn.edu/courses/molsyst-eeb5350/Simon%2C%20Buckley%2C%20Frati%2C%20Stewart%2C%20Beckenbach%202006%20AREES%20%26%20supplement.pdf}}Simon, Buckley, Frati, Stewart, Beckenbach 2006 AREES supplement.pdf. Lectures will examine some of the most serious problems in evolutionary tree construction: nucleotide bias, alignment, homoplasy, among-site rate variation, ...
http://hydrodictyon.eeb.uconn.edu/eebedia/index.php?title=Molecular_Systematics_Spring_2012&diff=21847&oldid=21846
*  Darwin's Evolutionary Tree 'Annihilated' | The Institute for Creation Research
Darwin s Evolutionary Tree Annihilated. Timely news related to creation and evolution. Life Sciences. Problems with Evolution. Evidence for Creation. Evidence for Truth. Evidence from Science. Apologetics Articles. ICR Store. Darwin's Evolutionary Tree 'Annihilated' by Brian Thomas, M.S. * Resources. Life Sciences Resources. Problems with Evolution. In 1837, Charles Darwin drew his first evolutionary tree in his B notebook, with the words I think scrawled above it, to illustrate his idea that all of today s species arose from a single common ancestor. But the poor fit of gene sequence data is forcing scientists to abandon the tree. A non-Darwinian evolutionary view has been offered, but this proposition is actually just the old Hopeful Monster with a twist. 3 Darwin s tree illustrated a long macroevolutionary past that never happened. 4 Finally, evolutionary biologists seem to be catching up with creation biologists. 5 Michael Syvanen, co-editor of Horizontal Gene Transfer 1998 and a medical biochemist at the...
http://icr.org/articles/view/4404/295/
*  Phylogenetic profiling
... 'Phylogenetic profiling' is a bioinformatics technique in which the joint presence or joint absence of two traits across large numbers of species is used to infer a meaningful biological connection, such as involvement of two different proteins in the same biological pathway. Along with examination of conserved synteny, conserved operon structure, or "Rosetta Stone" domain fusions, comparing phylogenetic profiles is a designated a "post-homology" technique, in that the computation essential to this method begins after it is determined which proteins are homologous to which. A number of these techniques were developed by David Eisenberg and colleagues; phylogenetic profile comparison was introduced in 1999 by Pellegrini, 'et al.' Pellegrini M, Marcotte EM, Thompson MJ, Eisenberg D, Yeates TO. Method Theory Advances and Challenges Notes. For a given protein family, its presence or absence in each genome in the original formulation is represented by 1 present and 0 absent. The large number of complete genom...
https://en.wikipedia.org/wiki/Phylogenetic_profiling
*  Structural Biochemistry/Analyzing protein structure and function using ancestral gene reconstruction
... - Wikibooks, open books for an open world. Structural Biochemistry/Analyzing protein structure and function using ancestral gene reconstruction. 1 Analyzing protein structure and function using ancestral gene reconstruction. Analyzing protein structure and function using ancestral gene reconstruction. Learning how protein sequence determines structure and function as well as learning the processes that generated the diverse structures and functions of extant proteins requires knowledge of the distribution of structures and functions through the multidimensional space of possible protein sequences. The outcomes of that massive experiment are preserved in the sequences, structures, and functions of modern-day protein families. Evolutionary analysis of these families can provide key insights into the nature of protein sequence space and the determinants of protein structure and function. Horizontal and Vertical Analysis. One way to study protein families is to identify candidate amino acid differences betwe...
https://en.wikibooks.org/wiki/Structural_Biochemistry/Analyzing_protein_structure_and_function_using_ancestral_gene_reconstruction
*  Patrocladogram
2 " and is used exclusively to determine the amount of divergence of a characteristic from a common ancestor. This means that cladistic and patristic distances are combined to construct a new tree using various phenetic algorithms. 3 The purpose of the patrocladogram in biological classification is to form a hypothesis about which evolutionary processes are actually involved before making a taxonomic decision. 4 Patrocladograms are based on biostatistics that include but are not limited to: parsimony, distance matrix, likelihood method s, and Bayesian probability. Some examples of genomically related data that can be used as inputs for these methods are: molecular sequences, whole genome sequences, gene frequencies, restriction site s, distance matrices, unique characters, mutations such as SNPs, and mitochondrial genome data. Cautions with patrocladogram usage Programs for patrocladogram analysis PATRISTIC. RAMI. Further reading References External links. Cautions with patrocladogram usage. Patrocladograms a...
https://en.wikipedia.org/wiki/Patrocladogram
*  SMART: DUF1866 domain taxonomic distribution
smart duf domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with duf domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing duf domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=DUF1866
*  SMART: DUF3700 domain taxonomic distribution
smart duf domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with duf domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing duf domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=DUF3700
*  SMART: PTPc motif domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with PTPc motif domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing PTPc motif domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=PTPc_motif
*  SMART: HOX domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with HOX domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing HOX domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=HOX
*  SMART: Citrate ly lig domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with Citrate ly lig domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing Citrate ly lig domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Citrate_ly_lig
*  SMART: Catalase domain taxonomic distribution
smart catalase domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with catalase domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing catalase domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Catalase
*  SMART: LRR RI domain taxonomic distribution
smart lrr ri domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with lrr ri domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing lrr ri domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=LRR_RI
*  SMART: Fib alpha domain taxonomic distribution
smart fib alpha domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with fib alpha domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing fib alpha domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Fib_alpha
*  SMART: Frataxin Cyay domain taxonomic distribution
smart frataxin cyay domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with frataxin cyay domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing frataxin cyay domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Frataxin_Cyay
*  SMART: Integrin B tail domain taxonomic distribution
smart integrin b tail domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with integrin b tail domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing integrin b tail domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Integrin_B_tail
*  SMART: BMC domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with BMC domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing BMC domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=BMC
*  SMART: GA domain taxonomic distribution
smart ga domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with ga domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing ga domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=GA
*  SMART: ELK domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with ELK domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing ELK domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=ELK
*  SMART: SEC14 domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with SEC14 domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing SEC14 domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=SEC14
*  SMART: CP12 domain taxonomic distribution
smart cp domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with cp domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing cp domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=CP12
*  SMART: NH domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with NH domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing NH domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=NH
*  SMART: DM13 domain taxonomic distribution
smart dm domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with dm domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing dm domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=DM13
*  SMART: LY domain taxonomic distribution
smart ly domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with ly domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing ly domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=LY
*  SMART: zf-AD domain taxonomic distribution
smart zf ad domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with zf ad domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing zf ad domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=zf-AD
*  SMART: Amelin domain taxonomic distribution
smart amelin domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with amelin domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing amelin domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Amelin
*  SMART: Ami 3 domain taxonomic distribution
smart ami domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with ami domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing ami domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Ami_3
*  SMART: CVNH domain taxonomic distribution
smart cvnh domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with cvnh domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing cvnh domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=CVNH
*  SMART: Cache 2 domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with Cache 2 domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing Cache 2 domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=Cache_2
*  SMART: DSPc domain taxonomic distribution
smart dspc domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with dspc domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing dspc domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=DSPc
*  SMART: GYR domain taxonomic distribution
smart gyr domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with gyr domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing gyr domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=GYR
*  SMART: MutL C domain taxonomic distribution
smart mutl c domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with mutl c domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing mutl c domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=MutL_C
*  SMART: NRF domain taxonomic distribution
smart nrf domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with nrf domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing nrf domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=NRF
*  SMART: PA14 domain taxonomic distribution
smart pa domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with pa domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing pa domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=PA14
*  SMART: ParB domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with ParB domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing ParB domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=ParB
*  SMART: RasGAP domain taxonomic distribution
... SMART MODE: NORMAL GENOMIC. Schultz et al. 1998 Proc. Natl. Acad. Sci. USA 95, 5857-5864 Letunic et al. 2014 Nucleic Acids Res doi: 10.1093/nar/gku949 HOME. SETUP. FAQ. ABOUT. GLOSSARY. WHAT'S NEW. FEEDBACK. Taxonomic distribution of proteins with RasGAP domain. A species tree will be displayed here if you enable JavaScript in your browser. Click on the protein counts, or double click on taxonomic names to display all proteins containing RasGAP domain in the selected taxonomic class. 2014 EMBL Send comments to Ivica Letunic....
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=RasGAP
*  SMART: VRR NUC domain taxonomic distribution
smart vrr nuc domain taxonomic distribution smart mode normal genomic schultz et al proc natl acad sci usa letunic et al nucleic acids res doi nar gku home setup faq about glossary what s new feedback taxonomic distribution of proteins with vrr nuc domain a species tree will be displayed here if you enable javascript in your browser click on the protein counts or double click on taxonomic names to display all proteins containing vrr nuc domain in the selected taxonomic class embl send comments to ivica letunic...
http://smart.embl-heidelberg.de/smart/complete_tree.cgi?ID=VRR_NUC

Domain (biology): In biological taxonomy, a domain (also superregnum, superkingdom, empire, or regio) is the highest taxonomic rank of organisms in the three-domain system of taxonomy designed by Carl Woese, an American microbiologist and biophysicist. According to the Woese system, introduced in 1990, the tree of life consists of three domains: Archaea (a term which Woese created), Bacteria, and Eukaryota.Branching order of bacterial phyla (Gupta, 2001): There are several models of the Branching order of bacterial phyla, one of these was proposed in 2001 by Gupta based on conserved indels or protein, termed "protein signatures", an alternative approach to molecular phylogeny. Some problematic exceptions and conflicts are present to these conserved indels, however, they are in agreement with several groupings of classes and phyla.Atmospheric methane: Atmospheric methane is the methane present in Earth's atmosphere. Atmospheric methane concentrations are of interest due to methane's impact on climate change, as it is one of the most potent greenhouse gases in Earth's atmosphere.Exogenous bacteria: Exogenous bacteria are microorganisms introduced to closed biological systems from the external world. They exist in aquatic and terrestrial environments, as well as the atmosphere.Coles PhillipsMethanopyrus: In taxonomy, Methanopyrus is a genus of the Methanopyraceae.See the NCBI webpage on Methanopyrus.Warner OlandFormate-nitrite transporter: Formate-nitrite transporters are a family of evolutionarily related transmembrane bacterial and archaebacterial proteins involved in transporting formate or nitrite. They include:Ignicoccus: Ignicoccus is a genus of Archaea living in marine hydrothermal vents. They were discovered in Kolbeinsey Ridge north of Iceland and in the Pacific Ocean (at 9 degrees N, 104 degrees W) in 2000 (Huber et al.Methanosarcinales S-layer Tile Protein: The Methanosarcinales S-layer Tile Protein (MSTP) is a protein family found almost exclusively in Methanomicrobia members of the order Methanosarcinales. Typically a tandem repeat of two DUF1608 domains are contained in a single MSTP protein chain and these proteins self-assemble into the protective proteinaceous surface layer (S-layer) structure that encompasses the cell.Halobacteriales: In taxonomy, the Halobacteriales are an order of the Halobacteria,See the NCBI webpage on Halobacteriales. Data extracted from the found in water saturated or nearly saturated with salt.Thermoacidophile: A thermoacidophile (combination of thermophile and acidophile) is an extreme archeon which thrives in acidous, sulfur-rich, high temperature environments with low availability of organic material.Archease: In molecular biology, the archease superfamily of proteins are represented in all three domains of life. Archease genes are generally located adjacent to genes encoding proteins involved in DNA or RNA processing and therefore been predicted to be modulators or chaperones involved in DNA or RNA metabolism.Nankai Trough gas hydrate site: Nankai Methane Hydrate Site (or Japanese Methane Hydrate R&D Program at Nankai, Nankai Trough Methane Hydrate Site) is located in the Nankai Trough, Japan.Methanocaldococcus jannaschii: Methanocaldococcus jannaschii (formerly Methanococcus jannas chii) is a thermophilic methanogenic archaea in the class Methanococci. It was the first archaeon to have its complete genome sequenced.Archaeoglobus: Archaeoglobus is a genus of the phylum Euryarchaeota.See the NCBI webpage on Archaeoglobus.Molecular evolution: Molecular evolution is a change in the sequence composition of cellular molecules such as DNA, RNA, and proteins across generations. The field of molecular evolution uses principles of evolutionary biology and population genetics to explain patterns in these changes.Deep chlorophyll maximum: A deep chlorophyll maximum (DCM) is a subsurface maximum in the concentration of chlorophyll in the ocean or a lake. A DCM is not always present--sometimes there is more chlorophyll at the surface than at any greater depth--but it is a common feature of most aquatic ecosystems.Thermococcus kodakarensis: Thermococcus kodakarensis is a species of thermophilic archaea. The type strain T.Methylated-thiol-coenzyme M methyltransferase: Methylated-thiol-coenzyme M methyltransferase (, mtsA (gene)) is an enzyme with system name methylated-thiol:coenzyme M methyltransferase. This enzyme catalyses the following chemical reactionAmmonia transporterProtein primary structure: The primary structure of a peptide or protein is the linear sequence of its amino acid structural units, and partly comprises its overall biomolecular structure. By convention, the primary structure of a protein is reported starting from the amino-terminal (N) end to the carboxyl-terminal (C) end.TEX86: TEX86 is an organic paleothermometer based upon the membrane lipids of mesophilic marine Thaumarchaeota (formerly Marine Group 1 Crenarchaeota).Schouten, S.Oxymonad: The Oxymonads are a group of flagellated protozoa found exclusively in the intestines of termites and other wood-eating insects. Along with the similar parabasalid flagellates, they harbor the symbiotic bacteria that are responsible for breaking down cellulose.Thermoplasma: In taxonomy, Thermoplasma is a genus of the Thermoplasmataceae.See the NCBI webpage on Thermoplasma.CS-BLASTDNA sequencer: A DNA sequencer is a scientific instrument used to automate the DNA sequencing process. Given a sample of DNA, a DNA sequencer is used to determine the order of the four bases: G (guanine), C (cytosine), A (adenine) and T (thymine).Amplified Ribosomal DNA Restriction Analysis: Amplified rDNA (Ribosomal DNA) Restriction Analysis is the extension of the technique of RFLP (restriction fragment length polymorphism) to the gene encoding the small (16s) ribosomal subunit of bacteria. The technique involves an enzymatic amplification using primers directed at the conserved regions at the ends of the 16s gene, followed by digestion using tetracutter Restriction enzymes.GvpA: GvpA is a gas vesicle structural protein found in different phyla of bacteria and archaea for example in Halobacterium salinarum or Haloferax mediterranei. Gas vesicles are small, hollow, gas filled protein structures found in several cyanobacterial and archaebacterial microorganisms.HEPN domain: In molecular biology, the HEPN domain (higher eukaryotes and prokaryotes nucleotide-binding domain) is a region of approximately 110 amino acids found in the C terminus of sacsin, a chaperonin implicated in an early-onset neurodegenerative disease in human, and in many bacterial and archaea proteins. There are three classes of proteins with HEPN domains:D-proline dehydrogenase: D-proline dehydrogenase (, D-Pro DH, D-Pro dehydrogenase, dye-linked D-proline dehydrogenase) is an enzyme with system name D-proline:acceptor oxidoreductase. This enzyme catalyses the following chemical reactionHalobacterium salinarum: Halobacterium salinarum is an extremely halophilic marine Gram-negative obligate aerobic archaeon. Despite its name, this microorganism is not a bacterium, but rather a member of the domain Archaea.Alliance for Zero Extinction: Formed in 2000 and launched globally in 2005, the Alliance for Zero Extinction (AZE) comprises 100 non-governmental biodiversity conservation organizations working to prevent species extinctions by identifying and safeguarding sites where species evaluated to be Endangered or Critically Endangered under International Union for Conservation of Nature (IUCN) criteria only exist at one location on earth."Zero Extinction - Home.Symmetry element: A symmetry element is a point of reference about which symmetry operations can take place. In particular, symmetry elements can be centers of inversion, axes of rotation and mirror planes.Acidophile: Acidophiles or acidophilic organisms are those that thrive under highly acidic conditions (usually at pH 2.0 or below).Horizontal gene transfer in evolutionMethanogen: Methanogens are microorganisms that produce methane as a metabolic byproduct in anoxic conditions. They are classified as archaea, a domain distinct from bacteria.Ferric uptake regulator family: In molecular biology, the ferric uptake regulator (FUR) family of proteins includes metal ion uptake regulator proteins. These are responsible for controlling the intracellular concentration of iron in many bacteria.Global microbial identifier: The genomic epidemiological database for global identification of microorganisms or global microbial identifier (GMI) is a platform for storing whole genome sequencing (WGS) data of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect and track-and-trace infectious disease outbreaks and emerging pathogens. The database holds two types of information: 1) genomic information of microorganisms, linked to, 2) metadata of those microorganism such as epidemiological details.Sulfolobales: In taxonomy, the Sulfolobales are an order of the Thermoprotei.See the NCBI webpage on Sulfolobales.Glucose-methanol-choline oxidoreductase family: In molecular biology, the glucose-methanol-choline oxidoreductase family (GMC oxidoreductase) is a family of enzymes with oxidoreductase activity.Reaction coordinateFecal coliform: A fecal coliform (British: faecal coliform) is a facultatively anaerobic, rod-shaped, gram-negative, non-sporulating bacterium. Coliform bacteria generally originate in the intestines of warm-blooded animals.Intramembrane protease: Intramembrane proteases (IMPs), also known as intermembrane-cleaving proteases (I-CLiPs), are enzymes that have the property of cleaving transmembrane domains of integral membrane proteins. All known intramembrane proteases are themselves integral membrane proteins with multiple transmembrane domains, and they have their active sites buried within the lipid bilayer of cellular membranes.EcosystemMcIntosh and Filde's anaerobic jar: McIntosh and Filde's anaerobic jar is an instrument used in the production of an anaerobic environment. This method of anaerobiosis as others is used to culture bacteria which die or fail to grow in presence of oxygen (anaerobes).T-box leaderSoil salinity control: Soil salinity control relates to controlling the problem of soil salinity and reclaiming salinized agricultural land.List of strains of Escherichia coli: Escherichia coli is a well studied bacterium that was first identified by Theodor Escherich, after whom it was later named.Gemmatimonadetes: The Gemmatimonadetes are a family of bacteria, given their own phylum (Gemmatimonadetes). This bacterium makes up about 2% of soil bacterial communities and has been identified as one of the top nine phyla found in soils; yet, there are currently only six cultured isolates.Continuous Plankton Recorder: The Continuous Plankton Recorder (CPR) survey is one of the longest running marine biological monitoring programmes in the world. Started in 1931 by Sir Alister Hardy, the CPR has provided marine scientists with their only measure of plankton communities on a pan-oceanic scale.Table of standard reduction potentials for half-reactions important in biochemistry: The values below are standard reduction potentials for half-reactions measured at 25°C, 1 atmosphere and a pH of 7 in aqueous solution.Transfer-messenger RNA: Transfer-messenger RNA (abbreviated tmRNA, also known as 10Sa RNA and by its genetic name SsrA) is a bacterial RNA molecule with dual tRNA-like and messenger RNA-like properties. The tmRNA forms a ribonucleoprotein complex (tmRNP) together with Small Protein B (SmpB), Elongation Factor Tu (EF-Tu), and ribosomal protein S1.BioreactorFishpaper: Fish paper or fishpaper is a strong, flexible, fibrous dielectric paper. It resists moderate heat and mechanical injury, and is often used for wrapping coils and insulating stove-top parts.Indian Ridge Hospital Open Invitational: The Indian Ridge Hospital Open Invitational was a PGA Tour satellite event that played for one year at the Indian Ridge Country Club in Andover, Massachusetts. The tournament, which was held in August 1969 and organized by Indian Ridge head club pro Ross Coon, benefited the Children's Hospital of Boston.FERM domain: In molecular biology, the FERM domain (F for 4.1 protein, E for ezrin, R for radixin and M for moesin) is a widespread protein module involved in localising proteins to the plasma membrane.Zetaproteobacteria: The class Zetaproteobacteria is the sixth and most recently described class of the Proteobacteria. Zetaproteobacteria can also refer to the group of organisms assigned to this class.Ecosystem of the North Pacific Subtropical Gyre: The North Pacific Subtropical Gyre (NPSG) is the largest contiguous ecosystem on earth. In oceanography, a subtropical gyre is a ring-like system of ocean currents rotating clockwise in the Northern Hemisphere and counterclockwise in the Southern Hemisphere caused by the Coriolis Effect.Desulfococcus oleovorans Strain Hxd3: Desulfococcus oleovorans Strain Hxd3 was isolated from the saline water phase of an oil-water separator from a northern German oil field.Aeckersberg, F.Wujing Zongyao: The Wujing Zongyao (), or the Complete Essentials for the Military Classics, is a Chinese military compendium written from around 1040 to 1044. It contains the earliest known written formulas for gunpowder, made from saltpeter, sulphur, and charcoal, along with many added ingredients.Haloarcula hispanica SH1 virus: Haloarcula hispanica SH1 virus is a double-stranded DNA virus that infects the archaeon Haloarcula hispanica.Bamford DH, Ravantti JJ, Rönnholm G, Laurinavicius S, Kukkaro P, Dyall-Smith M, Somerharju P, Kalkkinen N, Bamford JK (2005) Constituents of SH1, a novel lipid-containing virus infecting the halophilic euryarchaeon Haloarcula hispanica.Microbiota: A microbiota is "the ecological community of commensal, symbiotic and pathogenic microorganisms that literally share our body space". Joshua Lederberg coined the term, emphasising the importance of microorganisms inhabiting the human body in health and disease.List of hot springs: There are hot springs on all continents and in many countries around the world. Countries that are renowned for their hot springs include Honduras, Canada, Chile, Hungary, Iceland, Israel, Japan, New Zealand and United States, but there are interesting and unique hot springs in many other places as well.Sulfate-reducing bacteria: Sulfate-reducing bacteria are those bacteria and archaea that can obtain energy by oxidizing organic compounds or molecular hydrogen (H2) while reducing sulfate () to hydrogen sulfide (H2S). In a sense, these organisms "breathe" sulfate rather than oxygen in a form of anaerobic respiration.

(1/2228) Characterization of two novel haloalkaliphilic archaea Natronorubrum bangense gen. nov., sp. nov. and Natronorubrum tibetense gen. nov., sp. nov.

Two haloalkaliphilic archaea were isolated from a soda lake in Tibet. The two strains, designated A33T and GA33T, were Gram-negative, pleomorphic, flat, non-motile and strictly aerobic. Growth required at least 12% NaCl. Growth was between pH 8.0 and pH 11 with an optimum at pH 9.0-9.5. Cells were chemo-organotrophic. Polar lipids were C20-C25 derivatives of phosphatidylglycerol and phosphatidylglycerol phosphate. The nucleotide sequences of the 16S rRNA genes from the two strains were obtained by the analysis of the cloned rDNAs. On 16S rRNA phylogenetic trees, the two strains formed a monophyletic cluster. They differed from their closet neighbours, Halobacterium trapanicum and Natrialba asiatica, in polar lipid composition, as well as physiological and phenotypic characteristics. DNA-DNA hybridization indicated that the two strains belonged to different species of the same genus. The results indicated that the strains A33T and GA33T should be classified in a new genus Natronorubrum gen. nov. as Natronorubrum bangense sp. nov. (strain A33T) and Natronorubrum tibetense sp. nov. (strain GA33T).  (+info)

(2/2228) An evaluation of elongation factor 1 alpha as a phylogenetic marker for eukaryotes.

Elongation factor 1 alpha (EF-1 alpha) is a highly conserved ubiquitous protein involved in translation that has been suggested to have desirable properties for phylogenetic inference. To examine the utility of EF-1 alpha as a phylogenetic marker for eukaryotes, we studied three properties of EF-1 alpha trees: congruency with other phyogenetic markers, the impact of species sampling, and the degree of substitutional saturation occurring between taxa. Our analyses indicate that the EF-1 alpha tree is congruent with some other molecular phylogenies in identifying both the deepest branches and some recent relationships in the eukaryotic line of descent. However, the topology of the intermediate portion of the EF-1 alpha tree, occupied by most of the protist lineages, differs for different phylogenetic methods, and bootstrap values for branches are low. Most problematic in this region is the failure of all phylogenetic methods to resolve the monophyly of two higher-order protistan taxa, the Ciliophora and the Alveolata. JACKMONO analyses indicated that the impact of species sampling on bootstrap support for most internal nodes of the eukaryotic EF-1 alpha tree is extreme. Furthermore, a comparison of observed versus inferred numbers of substitutions indicates that multiple overlapping substitutions have occurred, especially on the branch separating the Eukaryota from the Archaebacteria, suggesting that the rooting of the eukaryotic tree on the diplomonad lineage should be treated with caution. Overall, these results suggest that the phylogenies obtained from EF-1 alpha are congruent with other molecular phylogenies in recovering the monophyly of groups such as the Metazoa, Fungi, Magnoliophyta, and Euglenozoa. However, the interrelationships between these and other protist lineages are not well resolved. This lack of resolution may result from the combined effects of poor taxonomic sampling, relatively few informative positions, large numbers of overlapping substitutions that obscure phylogenetic signal, and lineage-specific rate increases in the EF-1 alpha data set. It is also consistent with the nearly simultaneous diversification of major eukaryotic lineages implied by the "big-bang" hypothesis of eukaryote evolution.  (+info)

(3/2228) Unusual ribulose 1,5-bisphosphate carboxylase/oxygenase of anoxic Archaea.

The predominant pool of organic matter on earth is derived from the biological reduction and assimilation of carbon dioxide gas, catalyzed primarily by the enzyme ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO). By virtue of its capacity to use molecular oxygen as an alternative and competing gaseous substrate, the catalytic efficiency of RubisCO and the enzyme's ability to assimilate CO2 may be severely limited, with consequent environmental and agricultural effects. Recent genomic sequencing projects, however, have identified putative RubisCO genes from anoxic Archaea. In the present study, these potential RubisCO sequences, from Methanococcus jannaschii and Archaeoglobus fulgidus, were analyzed in order to ascertain whether such sequences might encode functional proteins. We also report the isolation and properties of recombinant RubisCO using sequences obtained from the obligately anaerobic hyperthermophilic methanogen M. jannaschii. This is the first description of an archaeal RubisCO sequence; this study also represents the initial characterization of a RubisCO molecule that has evolved in the absence of molecular oxygen. The enzyme was shown to be a homodimer whose deduced sequence, along with other recently obtained archaeal RubisCO sequences, differs substantially from those of known RubisCO molecules. The recombinant M. jannaschii enzyme has a somewhat low, but reasonable kcat, however, unlike previously isolated RubisCO molecules, this enzyme is very oxygen sensitive yet it is stable to hyperthermal temperatures and catalyzes the formation of the expected carboxylation product. Despite inhibition by oxygen, this unusual RubisCO still catalyzes a weak yet demonstrable oxygenase activity, with perhaps the lowest capacity for CO2/O2 discrimination ever encountered for any RubisCO.  (+info)

(4/2228) Fluorescence in situ hybridization using 16S rRNA-targeted oligonucleotides reveals localization of methanogens and selected uncultured bacteria in mesophilic and thermophilic sludge granules.

16S rRNA-targeted in situ hybridization combined with confocal laser scanning microscopy was used to elucidate the spatial distribution of microbes within two types of methanogenic granular sludge, mesophilic (35 degrees C) and thermophilic (55 degrees C), in upflow anaerobic sludge blanket reactors fed with sucrose-, acetate-, and propionate-based artificial wastewater. The spatial organization of the microbes was visualized in thin sections of the granules by using fluorescent oligonucleotide probes specific to several phylogenetic groups of microbes. In situ hybridization with archaeal- and bacterial-domain probes within granule sections clearly showed that both mesophilic and thermophilic granules had layered structures and that the outer layer harbored mainly bacterial cells while the inner layer consisted mainly of archaeal cells. Methanosaeta-, Methanobacterium-, Methanospirillum-, and Methanosarcina-like cells were detected with oligonucleotide probes specific for the different groups of methanogens, and they were found to be localized inside the granules, in both types of which dominant methanogens were members of the genus Methanosaeta. For specific detection of bacteria which were previously detected by whole-microbial-community 16S ribosomal DNA (rDNA)-cloning analysis (Y. Sekiguchi, Y. Kamagata, K. Syutsubo, A. Ohashi, H. Harada, and K. Nakamura, Microbiology 144:2655-2665, 1998) we designed probes specific for clonal 16S rDNAs related to unidentified green nonsulfur bacteria and clones related to Syntrophobacter species. The probe designed for the cluster closely related to Syntrophobacter species hybridized with coccoid cells in the inner layer of the mesophilic granule sections. The probe for the unidentified bacteria which were clustered with the green nonsulfur bacteria detected filamentous cells in the outermost layer of the thermophilic sludge granule sections. These results revealed the spatial organizations of methanogens and uncultivated bacteria and their in situ morphologies and metabolic functions in both mesophilic and thermophilic granular sludges.  (+info)

(5/2228) Universal conservation in translation initiation revealed by human and archaeal homologs of bacterial translation initiation factor IF2.

Binding of initiator methionyl-tRNA to ribosomes is catalyzed in prokaryotes by initiation factor (IF) IF2 and in eukaryotes by eIF2. The discovery of both IF2 and eIF2 homologs in yeast and archaea suggested that these microbes possess an evolutionarily intermediate protein synthesis apparatus. We describe the identification of a human IF2 homolog, and we demonstrate by using in vivo and in vitro assays that human IF2 functions as a translation factor. In addition, we show that archaea IF2 can substitute for its yeast homolog both in vivo and in vitro. We propose a universally conserved function for IF2 in facilitating the proper binding of initiator methionyl-tRNA to the ribosomal P site.  (+info)

(6/2228) 10-11 bp periodicities in complete genomes reflect protein structure and DNA folding.

MOTIVATION: Completely sequenced genomes allow for detection and analysis of the relatively weak periodicities of 10-11 basepairs (bp). Two sources contribute to such signals: correlations in the corresponding protein sequences due to the amphipatic character of alpha-helices and the folding of DNA (nucleosomal patterns, DNA supercoiling). Since the topological state of genomic DNA is of importance for its replication, recombination and transcription, there is an immediate interest to obtain information about the supercoiled state from sequence periodicities. RESULTS: We show that correlations within proteins affect mainly the oscillations at distances below 35 bp. The long-ranging correlations up to 100 bp reflect primarily DNA folding. For the yeast genome these oscillations are consistent in detail with the chromatin structure. For eubacteria and archaea the periods deviate significantly from the 10.55 bp value for free DNA. These deviations suggest that while a period of 11 bp in bacteria reflects negative supercoiling, the significantly different period of thermophilic archaea close to 10 bp corresponds to positive supercoiling of thermophilic archaeal genomes. AVAILABILITY: Protein sets and C programs for the calculation of correlation functions are available on request from the authors (see http://itb.biologie.hu-berlin.de).  (+info)

(7/2228) The euryarchaeotes, a subdomain of Archaea, survive on a single DNA polymerase: fact or farce?

Archaea is now recognized as the third domain of life. Since their discovery, much effort has been directed towards understanding the molecular biology and biochemistry of Archaea. The objective is to comprehend the complete structure and the depth of the phylogenetic tree of life. DNA replication is one of the most important events in living organisms and DNA polymerase is the key enzyme in the molecular machinery which drives the process. All archaeal DNA polymerases were thought to belong to family B. This was because all of the products of pol genes that had been cloned showed amino acid sequence similarities to those of this family, which includes three eukaryal DNA replicases and Escherichia coli DNA polymerase II. Recently, we found a new heterodimeric DNA polymerase from the hyperthermophilic archaeon, Pyrococcus furiosus. The genes coding for the subunits of this DNA polymerase are conserved in the euryarchaeotes whose genomes have been completely sequenced. The biochemical characteristics of the novel DNA polymerase family suggest that its members play an important role in DNA replication within euryarchaeal cells. We review here our current knowledge on DNA polymerases in Archaea with emphasis on the novel DNA polymerase discovered in Euryarchaeota.  (+info)

(8/2228) Two distinct SECIS structures capable of directing selenocysteine incorporation in eukaryotes.

Translation of UGA as selenocysteine requires specific RNA secondary structures in the mRNAs of selenoproteins. These elements differ in sequence, structure, and location in the mRNA, that is, coding versus 3' untranslated region, in prokaryotes, eukaryotes, and archaea. Analyses of eukaryotic selenocysteine insertion sequence (SECIS) elements via computer folding programs, mutagenesis studies, and chemical and enzymatic probing has led to the derivation of a predicted consensus structural model for these elements. This model consists of a stem-loop or hairpin, with conserved nucleotides in the loop and in a non-Watson-Crick motif at the base of the stem. However, the sequences of a number of SECIS elements predict that they would diverge from the consensus structure in the loop region. Using site-directed mutagenesis to introduce mutations predicted to either disrupt or restore structure, or to manipulate loop size or stem length, we show that eukaryotic SECIS elements fall into two distinct classes, termed forms 1 and 2. Form 2 elements have additional secondary structures not present in form 1 elements. By either insertion or deletion of the sequences and structures distinguishing the two classes of elements while maintaining appropriate loop size, conversion of a form 1 element to a functional form 2-like element and of a form 2 to a functional form 1-like element was achieved. These results suggest commonality of function of the two classes. The information obtained regarding the existence of two classes of SECIS elements and the tolerances for manipulations of stem length and loop size should facilitate designing RNA molecules for obtaining high-resolution structural information about these elements.  (+info)


what is the main difference between organisms in domain Archaea and domain Eukarya?


go to the biology section of science, education...

archaea r able to survive better in extreme condiotions like in valcanos and sulferic oceanic areas, eukarya is the most common one (we r made up of the eukarya, however we DO have archaea)


Archaea and Bacteria are different in that:?


Archaea and Bacteria are different in that: 
1. Archaea have some membrane-bound organelles 
2. Bacteria live in harsher environments than Archaea 
3. Archaea live in harsher environments than Bacteria 
4. Archaea lack DNA while Bacteria have DNA
----------

3. Archaea live in harsher environments than Bacteria 

PLEASE ANSWER MINE:

http://answers.yahoo.com/question/index;_ylt=AlTnWt09s_Q.2uOnfT74Kmbsy6IX;_ylv=3?qid=20090821190307AA9ZKUB


If bees are not animals?


If bees are not in fact classified in the Kingdom Animalia,
they which of the following would you put them in: 
Plantae, Fungi, Protista, Archaea, Bacteria?
Of course bees are animals. My question was directed at those who claim otherwise.
----------

they are animals
all bugs and insects are in the Animalia group

bees:
Kingdom: Animalia
Phylum: Arthropoda
Class: Insecta
Order: Hymenoptera
Suborder: Apocrita
Superfamily: Apoidea


____ are responsible for causing the common cold, chickenpox, and some cancers.?


a. Viruses
 b. Fungus
 c. Archaea
 d. Bacteria
----------